-
No products found
because this supplier's products are not listed.
Vanessa Meier-Stephenson, et al.,
bioRxiv - Biophysics 2021
Quote:
... ELISA plates were prepared using HBsAg capture Ab (Fitzgerald Industries International ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and homogenized in GUS extraction buffer before 1 µg of total protein extracts were used for enzymatic reactions at 37°C using 1 mM of the 4-MUG substrate (4-Methylumbelliferyl-β-D-glucuronide hydrate, Biosynth M-5700). GUS activity was measured using a FLUOstar Omega 96 microplate reader (BMG LABTECH ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
No products found
because this supplier's products are not listed.
Zilong Wang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... followed by filtration with 3 MWCO 96-well plate (Pall Corporation, Port Washington, NY). Kinetex XB-C18 ...
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
No products found
because this supplier's products are not listed.
Alexander P Bye, et al.,
bioRxiv - Immunology 2021
Quote:
... by shaking at 1200 rpm for 5 minutes at 37°C using a plate shaker (Quantifoil Instruments) after stimulating with collagen at a range of concentrations ...
-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jérémy Dufloo, et al.,
bioRxiv - Microbiology 2024
Quote:
... Correct insertion was checked by colony PCR using vector-specific primers (Forward: 5’-GAGAACCCACTGCTTACTGGC-3’; Reverse: 5’-AGGGTCAAGGAAGGCACG-3’) and the NZYTaq II 2x Green Master Mix (NZYtech). Plasmids with correct insertions were checked by Sanger (Eurofins ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Shanna H. Coop, Jacob L. Yates, Jude F Mitchell,
bioRxiv - Neuroscience 2022
Quote:
... We inserted tungsten 2.5- to 5-MΩ electrodes (1-3 FHC) that were mounted onto a lightweight screw micro-drive (Crist Instrument ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Roman Sloutsky, et al.,
bioRxiv - Biochemistry 2020
Quote:
... blotted for 5 s and plunge-frozen into liquid ethane using Cryoplunge 3 (Gatan).
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
S. Naseeb, et al.,
bioRxiv - Genetics 2021
Quote:
... high-resolution images of phenotypic plates were taken using Phenobooth after 3 days of incubation (Singer Instruments, UK). The colony sizes were calculated in pixels using Phenosuite software (Singer Instruments ...
-
ADAMTS-5 inhibitor
Sold for research purposes only.
Cat# 2083.0, SKU# 2083-25 mg,
25mg, US $539.00 / EA, EURO, €490 / EA
Ask
Anna S. Monzel, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Human NESCs were cultured on Matrigel-coated plates in N2B27 media supplemented with 3 µM CHIR-99021 (Axon Medchem), 0.75 µM purmorphamine (Enzo Life Science ...
-
No products found
because this supplier's products are not listed.
Manmeet Bhalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bacterial titers were confirmed by plating on tryptic soy agar plates supplemented with 5% sheep blood agar (Hardy Diagnostics).
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Biophysics 2023
Quote:
... the cells were stained with 200 μL of 5 mg/mL solution of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stain (Research Products International) in PBS ...
-
No products found
because this supplier's products are not listed.
Michael Ronzetti, et al.,
bioRxiv - Biochemistry 2022
Quote:
The DSF assay plate was constructed by dry-spotting 5 nL of SYPRO Orange with an acoustic dispenser (Echo 555, Labcyte) into a 384-well PCR plate ...
-
No products found
because this supplier's products are not listed.
Truc Do, et al.,
bioRxiv - Microbiology 2019
Quote:
... 0.6% 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Anatrace), 0.5% Triton X-100 reduced ...
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Fukumura, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... hnRNPH1: 5′-CUCUUGUCCAUCUAGAC-3′] used for the NMR titration was purchased (IBA Lifesciences).
-
No products found
because this supplier's products are not listed.
Valerie Y. Odeh-Couvertier, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 μL of 100/3 mM DSS-D6 in deuterium oxide (Cambridge Isotope Laboratories) were added to 1.7 mm NMR tubes (Bruker BioSpin) ...
-
No products found
because this supplier's products are not listed.
Bohm Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... which was crushed for 3 seconds with Dumont #5 forceps (Fine Science Tools, 11254-20) and special care was taken not to damage the vein sinus ...
-
No products found
because this supplier's products are not listed.
J. Michael Henderson, et al.,
bioRxiv - Cell Biology 2022
Quote:
Streptavidin-coated polystyrene beads (3 μm in diameter, SVP-30-5, 0.5% w/v, Spherotech) were washed three times in a 10X volume of PBS and recovered by centrifugation (12,000 rpm ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... a MACH 3 Rabbit HRP Polymer Detection kit (Biocare Medical # M3R531H) or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
F. Phil Brooks III, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a stack of one 5 mm and two 3 mm round cover glass (Thomas Scientific, 1217N66), pre-glued by optical glue (Norland 61) ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Kristen W. Cohen, et al.,
bioRxiv - Immunology 2021
Quote:
Samples were single-cell sorted into 96-well PCR plates containing 5 µL of DNA Suspension Buffer (Teknova) with 1% BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Yongrong Liao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
No products found
because this supplier's products are not listed.
Ghazal Vahidi, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by Rayon fine cloths and alumina pastes (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm, Ted Pella, Inc.).
-
No products found
because this supplier's products are not listed.
Hyeogsun Kwon, et al.,
bioRxiv - Immunology 2021
Quote:
Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Michael D. Roberts, et al.,
bioRxiv - Physiology 2023
Quote:
Peptides obtained from each of the five NP mixtures were separately reconstituted according in a solution of 0.1% formic acid and 3% acetonitrile (34) spiked with 5 fmol μL PepCalMix from SCIEX (Framingham, MA, USA). Reconstitution volumes varied by NP types to allow for constant peptide quantity for MS injection between samples regardless of starting volume (240 ng ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
David M. Zong, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... An aluminium plate seal (Diversified Biotech) was applied and the plate was frozen at -20 °C.