-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ho-Shiang Huang, Chan-Jung Liu,
bioRxiv - Biochemistry 2021
Quote:
Commercial kits were used to determine the urine level of NGAL (NGAL ELISA Kit, BioPorto Diagnostics A/S, Copenhagen, Denmark) and the urine levels of stone-induced renal tubular damage markers ...
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Rebecca Soffe, et al.,
bioRxiv - Microbiology 2019
Quote:
... a leaf colonising bacterium was grown overnight on nutrient agar plates (13 gL-1 Lysogeny broth and 15 gL-1 bacteriological Agar, Oxoid) containing 20 mg/L of gentamycin (AG Scientific) at 30 °C.52 The bacteria was then harvested using a sterile inoculation loop and was suspended in 5 ml of sterile phosphate buffer saline (PBS pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Kantak, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The 3-inch ballpoint sipper tube with a 1-inch bend (Ancare Corp., Bellmore, NY, USA) protruded 3.6 cm into the chamber ...
-
This kit is a sandwich ELISA assay for the quantitative measurement of ACAT1 in human serum,...
Cat# KITE1066,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... and blocked with ELISA diluent (5% nonfat milk [LabScientific, Danvers, MA, USA] in PBS-T) for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Caterina Prelli Bozzo, et al.,
bioRxiv - Microbiology 2023
Quote:
... the plates were washed and 100 μL SureBlue TMB 1-Component Microwell Peroxidase Substrate (Medac #52-00-04) was added ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Kelsey M. Tyssowski, Jesse M. Gray,
bioRxiv - Neuroscience 2019
Quote:
... The temperature was maintained by putting the plate on a 37°C warming plate (Bel-Art). The CO2 was maintained at 5% throughout the duration of the recording using the base provided with the Axion Lumos system ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Hiroshi Ochiai, et al.,
bioRxiv - Systems Biology 2019
Quote:
... in a 96-well PCR plate (BIOplastics).
-
No products found
because this supplier's products are not listed.
Kylie M. Konrath, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
FITC conjugated recombinant Mouse Kit (NP_001116205.1) extracellular domain (Met 1-Thr 523),...
Cat# Kit-4037MF,
50ug , USD $1298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Shoib S. Siddiqui, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3’-sialyllactose-PAA-biotinylated (Glycotech, Catalogue number-01-038), diluted in binding buffer ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
Mouse monoclonal antibody specific for Dengue membrane, virus type 1, 2 and 3
Cat# MAB12182-500,
500µg USD $762.6
Ask
Maya Imbrechts, et al.,
bioRxiv - Immunology 2021
Quote:
The binding of the purified recombinant antibodies to the following SARS-CoV-2 antigens was assessed via ELISA: spike glycoprotein (S1) RBD-His (REC31849-500, The Native Antigen Company), RBD(N439K)-His (40592-V08H14 ...
-
No products found
because this supplier's products are not listed.
Matteo Chighizola, et al.,
bioRxiv - Biophysics 2022
Quote:
... for 30 min at RT) glass-bottomed plates (Willco Wells). The fixed cells were characterised using a Bioscope Catalyst AFM from Bruker ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Joakim Karlsson, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cells were surface stained for 45 min in 37°C using Melanoma Dextramer Collection 1 kit from Immudex. Dead cells were excluded from the analysis using Live/Dead Aqua (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Oscar A. Campos, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... plates with gradually decreasing amounts of SC amino acid powder (Sunrise Science Products) were prepared ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Bert van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the test plate was washed twice with PBS and DirectPCR lysis reagent (Viagen) mixed 1:1 (vol ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Samuel J. Gonzalez, et al.,
bioRxiv - Cell Biology 2022
Quote:
20nm gold particles were coated with Eribulin by using an NHS-activated gold nanoparticle conjugation kit (Cytodiagnostics CGN5K-20-1), following the kit instructions ...
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Sebastian Schlaweck, et al.,
bioRxiv - Immunology 2024
Quote:
Splenic T cells were isolated by CD3e MACS kit (Miltenyi #130-094-973) from mice injected with 0.2 µg α-GalCer (1 nmol; Axxora, #ALX-306-027) 24h before ...
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Norman Zielke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The founder males of the second cross were transferred to 96-well plates and lysed with microLYSIS-PLUS (Cambio) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Hui Chen, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... plastic culture plates were coated with 20% Matrigel Matrix (CB40230C) and cells were plated in plating medium (BioIVT Z990003). After 4 h ...
-
No products found
because this supplier's products are not listed.
Vedagopuram Sreekanth, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were resuspended in 500 μL of hypertonic lysis buffer per plate (40 mM Tris base, 500 mM NaCl, 2 mM MgCl2, and 100 U/ml salt active nuclease (ArcticZymes), and were incubated at 37°C for 1 h to lyse the cells ...
-
No products found
because this supplier's products are not listed.
Sandy E Saunders, Joseph M. Santin,
bioRxiv - Physiology 2023
Quote:
... The agar block was then mounted on a vibrating microtome plate (Campden Vibrating Microtome 7000smz, Campden Instruments; Lafayette, IN, USA) and covered in ice-cold bubbled aCSF ...
-
No products found
because this supplier's products are not listed.
Benjamin Ng, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using the Quickzyme Total Collagen assay kit (Quickzyme Biosciences).
-
No products found
because this supplier's products are not listed.
Jeremy Rich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... visualized using the polink anti rat kit (GBI Labs) and the peroxidase/diaminobenzidine Rabbit PowerVision kit (ImmunoVision Technologies) ...
-
No products found
because this supplier's products are not listed.
Wenwei Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (Prolume). The neutralization half-maximal inhibitory dilution (IC50 ...