-
No products found
because this supplier's products are not listed.
Chaogang Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Phospho-ERK1- T202/Y204 + ERK2-T185/Y187 (ABclonal, AP0472), MAP2K1/MAP2K2 (ABclonal ...
-
No products found
because this supplier's products are not listed.
S. Zachary Swartz, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti phospho ERK1/2 T202/Y204 (Cell Signaling #9101 ...
-
No products found
because this supplier's products are not listed.
Logan J Massman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-Phospho-ERK1(T202/Y204)/ERK2(T185/Y187) (#AF1018, R&D systems), 1:500 ...
-
No products found
because this supplier's products are not listed.
Juliane Obst, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-ERK1/ERK2 antibody (9B3, abcam), followed by HRP-labelled anti-mouse or anti-rabbit IgG antibody (BioRad) ...
-
No products found
because this supplier's products are not listed.
Aroon S. Karra, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-pERK1/2 (T185/Y187) and mouse anti-Flag M2 (Sigma); and mouse anti-H3 and rabbit anti-H3K4 trimethyl (Active Motif).
-
No products found
because this supplier's products are not listed.
Rupesh Agarwal, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... ERK activation were assessed 20 min after treatment by using ERK1/2 (phospho-T203/Y204) ELISA Kit (Invitrogen) corrected for the amount of total ERK using ERK1/2 (Total ...
-
No products found
because this supplier's products are not listed.
Sapochnik Daiana, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-Phospho –ERK1/2 (Santa Cruz sc-7383), Anti-p38 (Santa Cruz sc-535-G) ...
-
No products found
because this supplier's products are not listed.
Alastair Copland, et al.,
bioRxiv - Immunology 2023
Quote:
... p-Erk1/2-T202/Y204-AF647 (4B11B69; Biolegend), NFAT1-AF647 (D43B1 ...
-
No products found
because this supplier's products are not listed.
Maria Cimpean, et al.,
bioRxiv - Immunology 2023
Quote:
... ERK1/2 (T202/Y204) (6B8B69, BD), anti-human IFN-γ (B27 ...
-
No products found
because this supplier's products are not listed.
Melanie A. MacMullan, et al.,
bioRxiv - Immunology 2022
Quote:
... RetroNectin (TaKara, T202) was bound to a non-tissue culture treated plate overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Optineurin Rabbit mAb (#10837-1-AP; Proteintech), NDP52 (60732 ...
-
No products found
because this supplier's products are not listed.
Joana F. da Rocha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-ERK1/2 (Millipore, Merck Life Science S.L.U., Portugal), rabbit anti-phosphorylated ERK1/2 (Thr202/Tyr204 Erk1 and Thr185/Tyr187 Erk2 ...
-
No products found
because this supplier's products are not listed.
Ekapot Singsuksawat, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then intracellularly stained with 4G2 mAbs followed by rabbit anti-mouse Igs FITC (Dako). The cells were fixed with 1% formaldehyde and analyzed on BD LSRFortessa ...
-
No products found
because this supplier's products are not listed.
Eloise Clarkson, Annabelle Lewis,
bioRxiv - Cancer Biology 2024
Quote:
... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
No products found
because this supplier's products are not listed.
Wai Tuck Soh, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-rat IgG-APC mAb (Jackson ImmunoResearch, West Grove, PA, USA).
-
No products found
because this supplier's products are not listed.
Lenka Koudelková, et al.,
bioRxiv - Cell Biology 2022
Quote:
... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
No products found
because this supplier's products are not listed.
John T. Killian Jr., et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human IgG1 mAbs were synthesized (Sino Biological) using the AA sequences derived from the predicted UCA nucleotide sequences.
-
No products found
because this supplier's products are not listed.
Ingrid R. Niesman,
bioRxiv - Cell Biology 2020
Quote:
... (Abcam; CHOP mAb #2895T, GFP rabbit mAb #2956T Novus Biologicals; TGN38 mAb #NB300-575SS ...
-
No products found
because this supplier's products are not listed.
Stefanie Jehle, et al.,
bioRxiv - Systems Biology 2021
Quote:
... secondary mAB anti-rabbit (donkey, GE Healthcare, LNA934V);
-
No products found
because this supplier's products are not listed.
Hervé Técher, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Rabbit anti-Phospho RPA32 (S33) and anti-Phospho RPA32 (S4/S8) were from Bethyl (used at 1/500 ...
-
No products found
because this supplier's products are not listed.
Chih-Chieh Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... rabbit phospho- and fluorescent antibodies (1:10,000, IRDye 800CW Donkey anti-Rabbit IgG, LI-COR #926-32213 and IRDye 680RD Donkey anti-Mouse IgG ...
-
No products found
because this supplier's products are not listed.
Wentao Chen, et al.,
bioRxiv - Microbiology 2023
Quote:
... ERK1/2 (1:1000, Bio-Rad Cat# MCA4695T), horseradish peroxidase-conjugated anti-rabbit (1:5000 ...
-
No products found
because this supplier's products are not listed.
Kelsey Briggs, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
Abhishek Kumar, Martin A Schwartz,
bioRxiv - Cell Biology 2023
Quote:
... rabbit polyclonal anti-Phospho Tyr165 p130Cas (GeneTex, GTX132160), rabbit polyclonal anti-G3BP2 (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
David Gonzalez-Perez, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Secondary antibody anti-Rabbit IgG conjugated to HRP (Goat mAb, Vector Laboratories, 1:8,000) was used for detection of proteins using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Martin Pauli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rabbit polyclonal and mAb anti-Zinc transporter 3 (ZnT3) (Synaptic Systems 197 002 and 197 011, 1:500). Secondary antibodies were used in the following concentrations ...
-
No products found
because this supplier's products are not listed.
Laurelle Jackson, et al.,
bioRxiv - Microbiology 2021
Quote:
... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
No products found
because this supplier's products are not listed.
Courtney F. Jungers, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
No products found
because this supplier's products are not listed.
R Ragazzini, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... H3 mAb (39163) and H3K27me2 mAb (61435) were purchased from Active Motif. Polyclonal Rabbit one against H3 from Cell Signaling Technology (9715) ...
-
No products found
because this supplier's products are not listed.
Yanyan Zheng, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Rabbit anti-phospho-ERK1/2 (1:1000, BM4156, Boster, China), Rabbit anti-ΔFosB (1:1000 ...
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
No products found
because this supplier's products are not listed.
Ting Zhou, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-phospho-Smad2 (Bioss, bs-24530R, dilution, 1:1000), rabbit anti-Smad3 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 2M7 mAb isolated from rabbit PBMCs was detected with an HRP-conjugated polyclonal mouse anti-rabbit IgG (Southern Biotech) and all the positive controls were detected with an HRP-conjugated polyclonal goat anti-human IgG (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Eva Rossmanith, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and HUVECs with a rabbit anti-human von Willebrand factor (vWF) mAb (2 μg/ml, Dianova, German) followed by goat anti-rabbit lgG Alexa Fluor® 594 (1:500 ...
-
No products found
because this supplier's products are not listed.
Anngela C. Adams, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... κ isotype control mAb (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Alessandra Cazzaniga, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... according to the manufacturer’s recommendations in combination with the stealth siRNAs for ERK2 (FlexiTube GeneSolution GS5594 for MAPK1, Qiagen, Hilden, Germany). Non-silencing ...
-
No products found
because this supplier's products are not listed.
Kostantin Kiianitsa, Nancy Maizels,
bioRxiv - Biochemistry 2020
Quote:
... a rabbit polyclonal raised against recombinant PARP1 (Enzo Life Sciences ALX-210-302-R100; 1:4000 dilution); anti-N-ter-PARP1 ...
-
No products found
because this supplier's products are not listed.
Federica Cariti, et al.,
bioRxiv - Plant Biology 2020
Quote:
... anti-phospho-LHCB2 (Agrisera; AS13-2705), anti-PsaA (a gift of Kevin Redding) ...
-
No products found
because this supplier's products are not listed.
Roman Generalov, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... that are knockout for the mouse FcRn heavy chain and express the genomic transgene of the human FcRn heavy chain under the control of the human FcRn promoter were used to study the plasma half-life of mAbs (Jackson laboratories (JAX), USA) ...
-
No products found
because this supplier's products are not listed.
Nuno Apóstolo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-BRINP2 (Atlas Antibodies), sheep anti-CNTN1 (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Mohammad B. Aljazi, et al.,
bioRxiv - Genetics 2020
Quote:
The mouse Erk1 gene gRNA (GGTAGAGGAAGTAGCAGATG) and mouse Erk2 gene gRNA (GGTTCTTTGACAGTAGGTC and CTTAGGGTTCTTTGACAGT) were cloned into pX330 vector obtained from Addgene. The target vector and pEF1a-pac vector were co-transfected (5:1 ratio ...
-
No products found
because this supplier's products are not listed.
Shubhi Pandey, et al.,
bioRxiv - Biochemistry 2019
Quote:
The ligand-induced phospho-ERK1/2 signaling was assessed using the AlphaLISA Surefire Ultra p-ERK1/2 (Thr202/Tyr204) kit (PerkinElmer) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shuai Hong, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Rabbit anti-Phospho-Y53-actin (MyBioSource #MBS474080), Chicken anti-MAP2 ...
-
No products found
because this supplier's products are not listed.
Kathryn M. Appleton, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Membranes were incubated in 1:1000 diluted primary antibodies pERK1/2 pT202/Y204 (Calbiochem cat# KP26001), total ERK1/2 (Cell Signaling cat# 9102) ...
-
No products found
because this supplier's products are not listed.
Krisztina Ötvös, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
No products found
because this supplier's products are not listed.
Mohammad M. Sajadi, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.5 μg/mL anti-CD40 mAb (Miltenyi Biotec) and CXCR5 antibody were added ...
-
No products found
because this supplier's products are not listed.
Marcela de Souza Santos, et al.,
bioRxiv - Microbiology 2019
Quote:
Large unilamellar vesicle liposomes containing 50 µMol each of cholesterol:cardiolipin (1’,3’-bis[1,2-dioleoyl-sn-glycero-3-phospho]-glycerol) or 50 µMol each of cholesterol:DOPS (1,2-dioleoyl-sn-glycero-3-phospho-L-serine) (Avanti Polar Lipids) were prepared as described previously (43) ...
-
No products found
because this supplier's products are not listed.
Katarzyna Olga Rojek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human recombinant VEGF-165 (Stemcell technologies; Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Mark A. Landy, Megan Goyal, Helen C. Lai,
bioRxiv - Developmental Biology 2021
Quote:
... 1:1000 rabbit anti-CGRP (Immunostar), 1:500 goat anti-TRKA (R&D Systems) ...