-
No products found
because this supplier's products are not listed.
K. Paterson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or PD-L1, purified anti-human CD274 (B7-H1, PD-L1) antibody (329701, Biolegend), were added at a 1:100 dilution for 24-48h and stored at 4°C ...
-
No products found
because this supplier's products are not listed.
Malkiel A. Cohen, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Rabbit anti-human-PD-L1 (1:300, Cell Signaling), Sheep anti-human-CD47 (1:100 ...
-
No products found
because this supplier's products are not listed.
Renpeng Ding, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-anti-human CD274(PD-L1) antibody (BD Pharmingen, 563741), PE-anti-human CD279(PD-1 ...
-
No products found
because this supplier's products are not listed.
Dimitrios Korentzelos, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse anti-human PD-L1 (28-8, Abcam). Secondary antibodies used were goat anti-mouse Alexa Fluor® 488 or goat anti-rabbit Alexa Fluor® 647 (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Anastasia-Maria Zavitsanou, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-PD-L1 (10F.9G2, Bioxcell) was used ...
-
No products found
because this supplier's products are not listed.
Hsiang-i Tsai, et al.,
bioRxiv - Bioengineering 2021
Quote:
... including Human PD-L1 and PD-1 were purchased from Invitrogen. Human LAG-3 and Na+K+ATPase antibodies were purchased from Cell Signaling Technology and Santa Cruz Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Johanna Straube, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human PD-L1 human IgG1 Fc chimera protein (R&D Systems), or mouse IgG1 isotype antibodies (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Xiaozheng Xu, et al.,
bioRxiv - Immunology 2021
Quote:
... human PD-L1-His (Sino Biological, #10084-H08H), human ICAM-1-His (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Lindsay B Alcaraz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PD-L1 (rabbit monoclonal, clone SP142, Roche) and CD163 (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Rui Sun, Hyeyoon Lee, Christof Niehrs,
bioRxiv - Bioengineering 2022
Quote:
... Human PD-L1-GFP (pEGFP-N1/PD-L1) was a gift from Mien-Chie Hung (Addgene plasmid # 121478 ...
-
No products found
because this supplier's products are not listed.
Farooq Syed, et al.,
bioRxiv - Physiology 2024
Quote:
... mouse anti-PD-L1 (Proteintech), and rabbit anti-CXCL10 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Michał Mikitiuk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The PD-1/PD-L1 immune checkpoint bioassay (PD-1/PD-L1 Bioassay, Promega) was performed according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Alexander G. Raufi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PD-L1 (clone 22C3; Dako; 1:150). Briefly ...
-
No products found
because this supplier's products are not listed.
Bogdan Musielak, et al.,
bioRxiv - Biophysics 2020
Quote:
... while recombinant PD-L1 (18 – 134 aa) and PD-L1-Long (19 – 238 aa) were cloned into pET-21b and pET-28a (Novagen), respectively ...
-
No products found
because this supplier's products are not listed.
Chih-Wei Chu, et al.,
bioRxiv - Immunology 2023
Quote:
... biotinylated human PD-L1 (ACROBioSystems, Newark, DE) and PE-conjugated streptavidin (Biolegend ...
-
No products found
because this supplier's products are not listed.
Siya Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
No products found
because this supplier's products are not listed.
Christian Hentrich, et al.,
bioRxiv - Biochemistry 2023
Quote:
Jurkat-Lucia TCR-hPD-1 effector cells and Raji-APC-hPD-L1 antigen presenting cells were obtained from Invivogen as components of the PD-1/PD-L1 Bio-IC assay (Invivogen, #rajkt-hpd1). The cells were cultivated in IMDM with glutamine and HEPES (Gibco ...
-
No products found
because this supplier's products are not listed.
Xiaopei Cui, et al.,
bioRxiv - Immunology 2023
Quote:
sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
No products found
because this supplier's products are not listed.
Fynn M. Hansen, et al.,
bioRxiv - Systems Biology 2020
Quote:
HEK293 (human, DMSZ, ACC 635) and U2OS (human, American Type Culture Collection [ATCC], HTB-96) cell were cultivated in DMEM (Gibco ...
-
No products found
because this supplier's products are not listed.
Scott E. James, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... CD22-deleted clones modified to express PD-L1 (LZRS PD-L1) or CD200 (PB-EF-1α-intron CD200, pCMV-hyPBase, SF buffer kit V4XC-2032, Lonza 4D Nucleofector, code DN100). Transposition reactions used 1-2 μg of vector DNA and 0.5-1.0 μg of pCMV-hyPBase transposase DNA ...
-
No products found
because this supplier's products are not listed.
Xinbo Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Free Flag peptides were removed using a PD-10 Desalting Column (GE Healthcare). The conjugate was further purified by a new PD-10 Desalting Column ...
-
No products found
because this supplier's products are not listed.
Irina Buckle, et al.,
bioRxiv - Immunology 2022
Quote:
... human IL-12p70 (HEK293) (Peprotech) and 50ng/ml recombinant human IL-18 (MBL International ...
-
No products found
because this supplier's products are not listed.
Yadira M. Soto-Feliciano, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Human HEK293 cells were maintained in DMEM (Corning) supplemented with 10% FBS (Gibco) ...
-
No products found
because this supplier's products are not listed.
Anny Gravdal, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
No products found
because this supplier's products are not listed.
Wenqiang Shi, et al.,
bioRxiv - Immunology 2022
Quote:
... PD-L1 (ABclonal, Wuhan, China) or TGF-β1 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Kayla Myers Chen, et al.,
bioRxiv - Immunology 2024
Quote:
... APC mouse PD-L1 from Tonbo Biosciences. In addition ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
αPD-L1: Rabbit anti-PD-L1 monoclonal IgG (mAb D8T4X, #86744 Cell Signaling, Euroclone, Milan, Italy). Immunolabeling dilution ...
-
No products found
because this supplier's products are not listed.
Nivedha Murali Shankar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Cells were stained with antibodies specific for PD-L1 (Miltenyi Biotec) and ErbB2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Roberto Cuttano, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
No products found
because this supplier's products are not listed.
Chloe G Myers, et al.,
bioRxiv - Cell Biology 2024
Quote:
Human embryonic kidney (HEK293) cells were cultured in Dulbeccoʹs Modified Eagleʹs Medium (DMEM, Merck) containing 10% Fetal Calf Serum and 1% Antibiotic Antimycotic Solution (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... anti-PD-L1 (GTX104763, GeneTex), anti-PD-1 (mouse specific)(#84651 ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
... and goat anti-human PD-L1 (1:50, Leinco Technologies, B560) at 4°C overnight and washed in PBS+0.1% Tween 20 for 5 min three times ...
-
PD-1/PD-L1 Inhibitor 3(Programmed Death-1/Programmed Death-Ligand 1 Inhibitor 3)is a Macrocyclic...
Cat# S8158, SKU# S8158-1mg,
1mg, $197.00
Ask
Vasu R Sah, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Absence of PD-L1 expression in the PD-L1 knockout cells was confirmed in cells treated with entinostat (Selleck Chemicals, Houston, TX) to induce PD-L1.
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... we transfected mouse PD-L1 double nickase plasmid (Santa Cruz Biotechnology, Dallas, TX, USA) into E0771 cells using X-tremeGENE transfection reagent ...
-
No products found
because this supplier's products are not listed.
Hideaki Yano, Leanne Liu, Sett Naing, Lei Shi,
bioRxiv - Biochemistry 2019
Quote:
... PD 144418 (Tocris), and haloperidol (Tocris)] were added to each well in serial dilution ...
-
No products found
because this supplier's products are not listed.
Yuichi Tsuchiya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HEK293 cells (4 × 106 cells/150 mm dish) were transiently transfected with pcDNA3-hFGF18-FLAG using PEI-MAX (Polysciences 24765). The culture medium was changed 24 hours after transfection ...
-
No products found
because this supplier's products are not listed.
Xiaotong Ji, et al.,
bioRxiv - Biophysics 2021
Quote:
... A biolistic PDS-1000He instrument (Bio-Rad, CA, USA) was used to bombard tobacco cells with this constructed plasmid ...
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... PD-L1 (Bioss, bsm-54472R) and mouse anti-GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was coated with hPD-L1-His protein and anti-PD-L1 antibody and anti-mouse IgG specific HRP conjugated secondary antibodies (SouthernBiotech, Birmingham, AL, USA) were added ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
... and PD-L1 (clone E1L3) internally validated on a fully automated platform (Leica Bond RX). Multispectral images were acquired using Polaris System (PerkinElmer/Akoya).
-
No products found
because this supplier's products are not listed.
Masaya Yamaguchi, et al.,
bioRxiv - Microbiology 2019
Quote:
Human TLR2/NF-κB/SEAP stably transfected HEK293 cells and human TLR4/MD-2/CD14/NF-κB/SEAP stably transfected HEK293 cells (Novus Biologicals, Centennial ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
No products found
because this supplier's products are not listed.
Yao Xiang, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-PD-L1 (4059, Prosci), Anti-Actin (A3854 ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... of PD-L1 protein/PD-L1 antibody was determined by Octet Biolayer interferometry (BLI) using the Octet RED384 system (Sartorius, Bohemia, NY, USA). Briefly ...
-
No products found
because this supplier's products are not listed.
Molly Fisher Thomas, et al.,
bioRxiv - Immunology 2021
Quote:
... and PanCK was performed using the Motif PD-1/PD-L1 panel (Akoya Biosciences OP-000001) on a Leica Bond Rx instrument (Leica Biosystems ...
-
No products found
because this supplier's products are not listed.
Yuhao Shi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
No products found
because this supplier's products are not listed.
Jillian M. DiMuzio, et al.,
bioRxiv - Immunology 2021
Quote:
... HEK293 cells expressing human Angiotensin converting enzyme 2 (ACE2) (BPS Biosciences, Cat #79951) were cultured in EMEM containing 10% FBS and 5 mg/mL Puromycin to select for ACE2-expressing cells ...
-
No products found
because this supplier's products are not listed.
Mohamed I. Gatie, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 1μM PD 0325901 (ApexBio). ES cells were passaged every 3–4 days using Accutase (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Masako Kohyama, et al.,
bioRxiv - Microbiology 2022
Quote:
... in which human ACE2 and TMPRSS2 are induced by tetracycline (HEK293-3P6C33 cells) with TransIT-LT1 Transfection Reagent (Mirus, Madison, WI, USA), following the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... PD-iPS cells were expanded on Matrigel in mTeSR1 media (Stemcell Technologies, 85850) with doxycycline (1 gg/ml ...