-
No products found
because this supplier's products are not listed.
Ann-Kathrin Mattes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... PD-L1 (BioLegend, 329713) and ICAM-1 (BD ...
-
No products found
because this supplier's products are not listed.
Meher Patel, et al.,
bioRxiv - Immunology 2022
Quote:
... PD-L1 (BD Pharmingen) and TLR4 (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... PD-L1 (Cell Signaling), TGFβ1 (Bioss) ...
-
No products found
because this supplier's products are not listed.
Anastasia-Maria Zavitsanou, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-PD-L1 (10F.9G2, Bioxcell) was used ...
-
No products found
because this supplier's products are not listed.
Zhixian Liu, et al.,
bioRxiv - Immunology 2021
Quote:
... or PD-L1 (Abcam, ab2134808) primary antibodies ...
-
No products found
because this supplier's products are not listed.
Hsiang-i Tsai, et al.,
bioRxiv - Bioengineering 2021
Quote:
... including Human PD-L1 and PD-1 were purchased from Invitrogen. Human LAG-3 and Na+K+ATPase antibodies were purchased from Cell Signaling Technology and Santa Cruz Biotechnology Inc ...
-
No products found
because this supplier's products are not listed.
Federica Liotti, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Soluble PD-L1 (sPD-L1) was from R&D systems (Minneapolis, MN, USA), Nivolumab was kindly provided by S ...
-
No products found
because this supplier's products are not listed.
Lindsay B Alcaraz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PD-L1 (rabbit monoclonal, clone SP142, Roche) and CD163 (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Farooq Syed, et al.,
bioRxiv - Physiology 2024
Quote:
... mouse anti-PD-L1 (Proteintech), and rabbit anti-CXCL10 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Odessa J Goudy, et al.,
bioRxiv - Biophysics 2023
Quote:
... biotinylated PD-L1 (Sino Biological, 10084-H08H-B ...
-
No products found
because this supplier's products are not listed.
Michał Mikitiuk, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The PD-1/PD-L1 immune checkpoint bioassay (PD-1/PD-L1 Bioassay, Promega) was performed according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Rui Sun, Hyeyoon Lee, Christof Niehrs,
bioRxiv - Bioengineering 2022
Quote:
... Human PD-L1-GFP (pEGFP-N1/PD-L1) was a gift from Mien-Chie Hung (Addgene plasmid # 121478 ...
-
No products found
because this supplier's products are not listed.
Alexander G. Raufi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PD-L1 (clone 22C3; Dako; 1:150). Briefly ...
-
No products found
because this supplier's products are not listed.
Bogdan Musielak, et al.,
bioRxiv - Biophysics 2020
Quote:
... while recombinant PD-L1 (18 – 134 aa) and PD-L1-Long (19 – 238 aa) were cloned into pET-21b and pET-28a (Novagen), respectively ...
-
No products found
because this supplier's products are not listed.
Xiaopei Cui, et al.,
bioRxiv - Immunology 2023
Quote:
sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
No products found
because this supplier's products are not listed.
Wenqiang Shi, et al.,
bioRxiv - Immunology 2022
Quote:
... anti-PD-L1 and LH02 were all purified by affinity chromatography using a protein A affinity column (GE Healthcare, Piscataway, NJ, USA) and analyzed in reducing condition on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
PD-L1 CAR haNK cells were assessed for PD-L1 CAR expression via staining with biotinylated recombinant human PD-L1 (ACROBiosystems) followed by staining with a fluorophore conjugated to streptavidin ...
-
No products found
because this supplier's products are not listed.
Kayla Myers Chen, et al.,
bioRxiv - Immunology 2024
Quote:
... APC mouse PD-L1 from Tonbo Biosciences. In addition ...
-
No products found
because this supplier's products are not listed.
Christian Hentrich, et al.,
bioRxiv - Biochemistry 2023
Quote:
Jurkat-Lucia TCR-hPD-1 effector cells and Raji-APC-hPD-L1 antigen presenting cells were obtained from Invivogen as components of the PD-1/PD-L1 Bio-IC assay (Invivogen, #rajkt-hpd1). The cells were cultivated in IMDM with glutamine and HEPES (Gibco ...
-
No products found
because this supplier's products are not listed.
Martina Ruglioni, et al.,
bioRxiv - Biophysics 2023
Quote:
αPD-L1: Rabbit anti-PD-L1 monoclonal IgG (mAb D8T4X, #86744 Cell Signaling, Euroclone, Milan, Italy). Immunolabeling dilution ...
-
PD-1/PD-L1 Inhibitor 3(Programmed Death-1/Programmed Death-Ligand 1 Inhibitor 3)is a Macrocyclic...
Cat# S8158, SKU# S8158-1mg,
1mg, $197.00
Ask
Vasu R Sah, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Absence of PD-L1 expression in the PD-L1 knockout cells was confirmed in cells treated with entinostat (Selleck Chemicals, Houston, TX) to induce PD-L1.
-
No products found
because this supplier's products are not listed.
Wenqiang Shi, et al.,
bioRxiv - Immunology 2022
Quote:
... PD-L1 (ABclonal, Wuhan, China) or TGF-β1 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Roberto Cuttano, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
No products found
because this supplier's products are not listed.
Xiaotong Ji, et al.,
bioRxiv - Biophysics 2021
Quote:
... A biolistic PDS-1000He instrument (Bio-Rad, CA, USA) was used to bombard tobacco cells with this constructed plasmid ...
-
No products found
because this supplier's products are not listed.
Youichi Tajima, Futoshi Shibasaki, Hisao Masai,
bioRxiv - Cancer Biology 2022
Quote:
... anti-PD-L1 (GTX104763, GeneTex), anti-PD-1 (mouse specific)(#84651 ...
-
No products found
because this supplier's products are not listed.
Scott E. James, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... CD22-deleted clones modified to express PD-L1 (LZRS PD-L1) or CD200 (PB-EF-1α-intron CD200, pCMV-hyPBase, SF buffer kit V4XC-2032, Lonza 4D Nucleofector, code DN100). Transposition reactions used 1-2 μg of vector DNA and 0.5-1.0 μg of pCMV-hyPBase transposase DNA ...
-
No products found
because this supplier's products are not listed.
Nivedha Murali Shankar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Cells were stained with antibodies specific for PD-L1 (Miltenyi Biotec) and ErbB2 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Siya Zhang, et al.,
bioRxiv - Biophysics 2021
Quote:
... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
No products found
because this supplier's products are not listed.
Hideaki Yano, Leanne Liu, Sett Naing, Lei Shi,
bioRxiv - Biochemistry 2019
Quote:
... PD 144418 (Tocris), and haloperidol (Tocris)] were added to each well in serial dilution ...
-
No products found
because this supplier's products are not listed.
Eirini Tsirvouli, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and PD: PD0325901 (all Merck) were solved in DMSO at stock concentrations of 20 mM.
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... PD-L1 (Bioss, bsm-54472R) and mouse anti-GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Yao Xiang, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-PD-L1 (4059, Prosci), Anti-Actin (A3854 ...
-
No products found
because this supplier's products are not listed.
Molly Fisher Thomas, et al.,
bioRxiv - Immunology 2021
Quote:
... and PanCK was performed using the Motif PD-1/PD-L1 panel (Akoya Biosciences OP-000001) on a Leica Bond Rx instrument (Leica Biosystems ...
-
No products found
because this supplier's products are not listed.
Yukiko Yamaguchi, et al.,
bioRxiv - Immunology 2022
Quote:
... and goat anti-human PD-L1 (1:50, Leinco Technologies, B560) at 4°C overnight and washed in PBS+0.1% Tween 20 for 5 min three times ...
-
No products found
because this supplier's products are not listed.
Brandon C. Smith, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 100 nM PD-1/PD-L1 inhibitor (Thomas Scientific; C790F18), and/or 1.0 μg/mL PD-1 agonist (BioLegend ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... we transfected mouse PD-L1 double nickase plasmid (Santa Cruz Biotechnology, Dallas, TX, USA) into E0771 cells using X-tremeGENE transfection reagent ...
-
No products found
because this supplier's products are not listed.
Yvette Robbins, et al.,
bioRxiv - Immunology 2020
Quote:
... and PD-L1 (clone E1L3) internally validated on a fully automated platform (Leica Bond RX). Multispectral images were acquired using Polaris System (PerkinElmer/Akoya).
-
No products found
because this supplier's products are not listed.
Sangnam Kim, Sangpil Yoon,
bioRxiv - Bioengineering 2022
Quote:
3T3-L1 (American Type Culture Collection (ATCC, USA)) cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... of PD-L1 protein/PD-L1 antibody was determined by Octet Biolayer interferometry (BLI) using the Octet RED384 system (Sartorius, Bohemia, NY, USA). Briefly ...
-
Cat# IT-45-25,
25 micrograms,USD $303.0
Ask
Judith Jing Wen Wong, Pål Kristian Selbo,
bioRxiv - Cancer Biology 2021
Quote:
The immunotoxin anti-human PD-L1-saporin (Anti-PD-L1-SAP, BETA-014) was generously provided by Advanced Targeting Systems (ATS, Carlsbad, CA, USA). The targeted toxin is a 295 kDa conjugate between a rabbit polyclonal antibody to human PD-L1 and the secondary conjugate streptavidin-saporin ...
-
No products found
because this supplier's products are not listed.
Kateřina Kuželová, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PD-L1-PE (#1P-177-T100) from Exbio (Prague, Czech Republic). HLA class I antibody (ab2217 ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... the membranes were incubated with the following primary antibodies overnight at 4 ℃: PD-L1 (1:1000, Bioworld), p-Stat3 (1:1000 ...
-
PD-1 inhibitor
Sold for research purposes only.
Cat# 3694.0, SKU# 3694-5 mg,
Inquire
Ask
Jonathan Bayerl, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and PD0325901 (PD, 1μM – Axon Medchem 1408). Murine naïve ESCs and iPSCs were expanded on gelatin-coated plates ...
-
No products found
because this supplier's products are not listed.
Yuhao Shi, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
No products found
because this supplier's products are not listed.
Michael C. Kiritsy, et al.,
bioRxiv - Immunology 2020
Quote:
... and PD-L1 were performed as follows: 2e8 cells of the knockout (KO) library was stimulated with IFNγ (10ng/mL; Peprotech 315-05) for 24 hours after which cells were harvested by scraping to ensure integrity of cell surface proteins ...
-
No products found
because this supplier's products are not listed.
Yunlong Zhao, et al.,
bioRxiv - Immunology 2019
Quote:
... total cell lysate was applied for SDS-PAGE and detected by anti-PD-L1 PE (eBioscience, catalog 14-5983-82) and anti-CD80 (Novus Biologicals, NBP2-25255). The latter was further detected by using DyLight488 anti-mouse IgG (Biolegend ...
-
No products found
because this supplier's products are not listed.
Catarina Nascimento, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the exons of interest in PD-L1 gene were amplified by using specific primers (Table 5) with a PCR thermal cycler (VWR Thermocycler, Leicestershire, England). PCR procedures were performed with a standard reaction mixture (4 μl/sample of Phusion GC Buffer (Thermo Fischer Scientific) ...
-
No products found
because this supplier's products are not listed.
Mingming Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
No products found
because this supplier's products are not listed.
JP Mann, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mature (day +8) differentiated 3T3-L1 adipocytes were reseeded onto matrigel-coated (Corning) coverslips at 50% density ...
-
No products found
because this supplier's products are not listed.
Kaitao Li, et al.,
bioRxiv - Immunology 2023
Quote:
All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...