-
No products found
because this supplier's products are not listed.
Camden R. Bair, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 8% heat-inactivated newborn calf serum (HI-NBCS, Rocky Mountain Biologicals), 1.5 g/ml Na2CO3 (Amresco) ...
-
No products found
because this supplier's products are not listed.
Kyungho Kim, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-KLHL12 (#30058, 1:1000, ProMab Biotechnology, Richmond, CA,USA), rabbit anti-KLHL40 (#HPA024463 ...
-
No products found
because this supplier's products are not listed.
Ronan Shaughnessy, et al.,
bioRxiv - Cell Biology 2023
Quote:
... lentivi-ral particles were produced in the HEK293 FT packaging cells transfected with MiniBAR constructs and the Excelenti LTX Lentivirus Packaging mix (Oxford Genetics) using lipo-fectamine following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and immunostained with the following antibodies: mouse anti-HCV NS4A (Genotype 1B, 1:100, Virogen), rabbit anti-HA (1:100 ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Raveen Rathnasinghe, et al.,
bioRxiv - Microbiology 2021
Quote:
... were maintained in Dulbecco’s Modified Eagle Medium (DMEM) complemented with 10% heat-inactivated Fetal Bovine Serum (HI-FBS; PEAK serum), penicillin-streptomycin (Gibco ...
-
No products found
because this supplier's products are not listed.
Cunxi Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The Mpp75Aa1.1-His fractions identified by SDS-PAGE were pooled and further processed using EndoTrap® HD (Hyglos GmbH, Germany) to reduce endotoxin contents (manufacturer’s instruction) ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Cassidy M.R. Blackburn, et al.,
bioRxiv - Immunology 2020
Quote:
... media was removed and replaced with either D-10 (untreated) or D-10 + 50μg/ml oxidized LDL (hi oxLDL Kalen biomedical 770252-60) for 2 hours ...
-
No products found
because this supplier's products are not listed.
Laura Mathä, et al.,
bioRxiv - Immunology 2023
Quote:
... FITC-conjugated anti-mouse anti-mouse T1/ST2 (DJ8) was purchased from MD Biosciences. BV605- conjugated anti-human CD45 (HI30 ...
-
No products found
because this supplier's products are not listed.
B. van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... was used for MDA-MB-436 and mouse targeting shEXO1 (see Table 1 for sequence, cloned in pRSITEP-U6Tet-sh-EF1-TetRep-2A-Puro from Cellecta Catalog #: SVSHU6T16-L) was used for MEFs.
-
No products found
because this supplier's products are not listed.
Didier Hodzic, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Multi-Trol mouse serum controls (Drew Scientific, Inc.) were used for calibration of the Hemavet HV950 ...
-
No products found
because this supplier's products are not listed.
Tim Vangansewinkel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A mouse intrathecal catheter (Alzet®, DURECT Corp.) was carefully inserted via this opening into the intrathecal space at the midline ...
-
No products found
because this supplier's products are not listed.
Valentin Greigert, et al.,
bioRxiv - Microbiology 2023
Quote:
... Crypt-a-glo TM (mouse mAb, Waterborne, Inc) was used at 1 drop per transwell ...
-
No products found
because this supplier's products are not listed.
Malachy Guzman, et al.,
bioRxiv - Genetics 2023
Quote:
... Each mouse was weighed with a analytical laboratory scale (Ohaus) immediately prior to recording ...
-
No products found
because this supplier's products are not listed.
Kyle Vaccaro, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cells were blocked with 100 ug/mL mouse IgG (Lampire Biological Laboratories) or Human TruStain FcX (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Damian L. Trujillo, et al.,
bioRxiv - Immunology 2019
Quote:
Purified mouse-adapted influenza A/PR/8/34 (H1N1) was purchased from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
Karl A. Johnson, et al.,
bioRxiv - Biophysics 2020
Quote:
... we imaged a GFP labelled mouse brain sample acquired from SunJin Lab (Hsinchu City, Taiwan). This sample is a 250um thick coronal section which was cleared and mounted by SunJin Lab using the RapiClear 1.52 reagent.
-
No products found
because this supplier's products are not listed.
Nicole Fazio, et al.,
bioRxiv - Biophysics 2023
Quote:
... ε260 = 8700 M− 1cm−1 for TMP) and ε260 = 4930 M−1 cm−1 for Cy3 and ε260 = 10000 M−1 cm−1 for Cy5 (Glen Research) based on the sequence of each DNA strand (Supplementary Table S1) ...
-
No products found
because this supplier's products are not listed.
Zhenyue Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The mouse head was immobilized using a custom stereotactic frame (Narishige International Limited, London, United Kingdom). During the experiment ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ilaria Russo, et al.,
bioRxiv - Physiology 2024
Quote:
Total RNA was extracted from mouse RV tissue using the Tissue RNA Purification Kit (Norgen Biotek) and motorized tissue grinder (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Aminata P. Coulibaly, et al.,
bioRxiv - Neuroscience 2019
Quote:
The arterial tree of each mouse was labeled using the vascular dye Microfil (Flow Tech, Carver, MA), and the cross-sectional MCA diameter was measured ...
-
No products found
because this supplier's products are not listed.
Tsunaki Hongu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mice were intravenously injected with clodronate-liposome (100-150 μl per mouse, every other day, Liposoma BV). Short-term experiments were performed by treatment with clodronate-liposome on day 14 ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Chanchal Thomas Mannully, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1 μM PD0325901 (Biogems, Peprotech), mouse Leukemia inhibitory factor (LIF ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jared D. Chrispell, Yubin Xiong, Ellen R. Weiss,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit polyclonal antibodies against zebrafish Grk7 (27) and phosphorylated mouse Grk1 (17) were generated by 21st Century Biochemicals (Marlboro, MA, USA). A novel rabbit polyclonal antibody against phosphorylated zebrafish GRK1 was also generated by 21st Century Biochemicals using the peptide ISARG[pS]FDGTAN corresponding to amino acids 16-27 of zebrafish Grk1a ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
because this supplier's products are not listed.
Sebastian Hutchinson, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and 1 µM DY-647 (Dyomics), the beads mix contains BHMs (1CellBio ...
-
No products found
because this supplier's products are not listed.
Kai-Ting Huang, et al.,
bioRxiv - Physiology 2024
Quote:
... IP3R2 (Antibody Research Corporation; 1:1000), IP3R3 (BD Transduction Laboratory ...
-
No products found
because this supplier's products are not listed.
Mukaddes Izci, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Appropriate dilutions of 1 g L-1 single element standard solutions of Au and Tl (Inorganic Ventures, USA) were used for method development ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Pranay Mandal, et al.,
bioRxiv - Neuroscience 2020
Quote:
Rhodamine-phalloidin (#6876, 1:125, Setareh Biotech, USA) was added along with secondary antibody during immunocytochemistry.
-
No products found
because this supplier's products are not listed.
Chaim Glück, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a glass pipette was inserted into the lumen of the MCA and 1 μL of thrombin (1 UI; HCT-0020, Haematologic Technologies Inc) was injected to induce in situ clot formation (Fig ...
-
No products found
because this supplier's products are not listed.
Yury A. Nikolaev, et al.,
bioRxiv - Physiology 2020
Quote:
... 1 µM SNX-482 (from Alomone or Peptides International), 5 µM Mibefradil*2HCl ...
-
No products found
because this supplier's products are not listed.
Christopher J. Handwerk, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and placed a #1 coverslip (Globe Scientific #1315-10) on top ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Systems Biology 2020
Quote:
Liver samples were defrosted on ice and homogenized in 1 mL of PBS in tubes containing 1 mm zirconium beads (OPS Diagnostics, Lebanon, NJ, USA) on a Mini Bead Beater homogenizer (BioSpec products ...
-
No products found
because this supplier's products are not listed.
Mosale Seetharam Sumanth, et al.,
bioRxiv - Biochemistry 2020
Quote:
... were incubated with sAGP-1 or nAGP-1 (25, 50 and 100 μg/ml) in triplicate wells in twelve well cell culture plates (Nest Biotechnology Co. Ltd., China) pre-coated with 0.2% gelatin ...
-
No products found
because this supplier's products are not listed.
Alvaro Alonso-Caballero, et al.,
bioRxiv - Biophysics 2019
Quote:
... and 1% w/v of sulfhydryl-blocked BSA (Lee Biosolutions)) ...
-
No products found
because this supplier's products are not listed.
Stavroula Bitsi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 1 mg/mL collagenase from Clostridium histolyticum (S1745602, Nordmark Biochemicals), dissected ...
-
No products found
because this supplier's products are not listed.
Ioanna Smyrlaki, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and additional respective emission filter described later (Table 1.) (Chroma Technology) and the signal was recorded with an iXon Ultra 888 EMCCD camera (Andor ...
-
No products found
because this supplier's products are not listed.
Clara Lambert, et al.,
bioRxiv - Microbiology 2023
Quote:
... essentially composed of C18:1Δ9 or 100 μM C17:1 (Larodan, Sweden). Overnight cultures were diluted to an OD600nm = 0.05 and grown in the indicated medium to the exponential phase (OD600nm comprised between 0.4 and 0.5).
-
No products found
because this supplier's products are not listed.
Stephan Kamrad, et al.,
bioRxiv - Genetics 2019
Quote:
... The ‘1 to 16 array single source’ program of the RoToR HDA (Singer Instruments) was used to create the readout plates ...
-
No products found
because this supplier's products are not listed.
Astrid M. Alsema, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Reads from bulk samples were deduplicated using a bash script by BIOO Scientific (v2, date 11/1/14), using the NEXTflex barcode that was saved in the additional file ...