-
No products found
because this supplier's products are not listed.
Cristina Aguirre-Portolés, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PARP (Cell Signaling Technology, Rabbit mAb #9542. 1:1000), YAP1 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Amrita Mukherjee, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Rabbit anti-PARP (1:500, Abcam ab2317), Mouse anti-EcR (1:5 ...
-
No products found
because this supplier's products are not listed.
Jessica L. Rausch, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... PARP (Invitrogen), cleaved PARP (Abcam ...
-
No products found
because this supplier's products are not listed.
Chantal Reigada, et al.,
bioRxiv - Microbiology 2019
Quote:
... incubated over night with rabbit anti-PARP antibodies (Santa Cruz Biotechnology) diluted 1:500 or anti-PAR reagent (MABE 1016 ...
-
No products found
because this supplier's products are not listed.
Julian Lutze, Donald Wolfgeher, Stephen J. Kron,
bioRxiv - Cancer Biology 2021
Quote:
... histone H3K27me3 (rabbit, mAb, clone C36B11, CST) histone H3 (mouse, mAb, clone 6.6.2, Millipore Sigma), RNA Polymerase 2 (rabbit polyclonal ...
-
No products found
because this supplier's products are not listed.
Nadine Pollak, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-PARP (BD Biosciences), rabbit anti-Phospho-Histone H2A.X (Ser139 ...
-
No products found
because this supplier's products are not listed.
John T. Killian Jr., et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human IgG1 mAbs were synthesized (Sino Biological) using the AA sequences derived from the predicted UCA nucleotide sequences.
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Optineurin Rabbit mAb (#10837-1-AP; Proteintech), NDP52 (60732 ...
-
No products found
because this supplier's products are not listed.
Zoya Mann, et al.,
bioRxiv - Cell Biology 2023
Quote:
Rabbit mAb against NMIIB (Biolegend, Cat#909901)
-
No products found
because this supplier's products are not listed.
Chueh-Hsuan Lu, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cleaved PARP and GAPDH (GeneTex) were used ...
-
No products found
because this supplier's products are not listed.
Li-Feng-Rong Qi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... GRB2 Rabbit mAb (cat. No. A19059, ABclonal, China), ERK1/ERK2 Rabbit pAb (cat ...
-
No products found
because this supplier's products are not listed.
Laurelle Jackson, et al.,
bioRxiv - Microbiology 2021
Quote:
... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
No products found
because this supplier's products are not listed.
Marc Beltrà, et al.,
bioRxiv - Molecular Biology 2022
Quote:
PARP activity was analyzed from pulverized liver and gastrocnemius (GSN) muscle utilizing HT Colorimetric PARP/Apoptosis Assay Kit (R&D Systems, Minneapolis, MN, USA) according to manufacturer’s instructions (n=6-8 per group) ...
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
No products found
because this supplier's products are not listed.
Stefanie Jehle, et al.,
bioRxiv - Systems Biology 2021
Quote:
... secondary mAB anti-rabbit (donkey, GE Healthcare, LNA934V);
-
No products found
because this supplier's products are not listed.
Jordan F. Hastings, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... total P53 and cleaved PARP (Biorad). The data was normalized to the median value at the 0 h time point for each analyte and a log transformation was conducted on the resulting dataset ...
-
No products found
because this supplier's products are not listed.
Ekapot Singsuksawat, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then intracellularly stained with 4G2 mAbs followed by rabbit anti-mouse Igs FITC (Dako). The cells were fixed with 1% formaldehyde and analyzed on BD LSRFortessa ...
-
No products found
because this supplier's products are not listed.
Eloise Clarkson, Annabelle Lewis,
bioRxiv - Cancer Biology 2024
Quote:
... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
No products found
because this supplier's products are not listed.
Dorothea Höpfner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
No products found
because this supplier's products are not listed.
Anngela C. Adams, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... κ isotype control mAb (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Ingrid R. Niesman,
bioRxiv - Cell Biology 2020
Quote:
... (Abcam; CHOP mAb #2895T, GFP rabbit mAb #2956T Novus Biologicals; TGN38 mAb #NB300-575SS ...
-
No products found
because this supplier's products are not listed.
Sarah Vogt, et al.,
bioRxiv - Plant Biology 2021
Quote:
The PARP activity assay was performed with the PARP Universal Colorimetric Assay Kit (Trevigen) according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Sridevi Challa, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
The custom rabbit polyclonal antiserum against PARP-1 was generated in-house by using purified recombinant amino-terminal half of PARP-1 as an antigen (now available Active Motif; cat. no. 39559). The custom recombinant antibody-like anti-poly-ADP-ribose binding reagent (anti-PAR ...
-
No products found
because this supplier's products are not listed.
David Sitbon, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
No products found
because this supplier's products are not listed.
Clément Demongin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Primary antibodies for FUS (α-FUS rabbit, mAB ABnova) and TDP-43 (α-TDP-43 mousse ...
-
No products found
because this supplier's products are not listed.
Courtney F. Jungers, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
No products found
because this supplier's products are not listed.
Yuhao Wang, Linhao Ruan, Rong Li,
bioRxiv - Cell Biology 2023
Quote:
... mAb clone JL-8 (632381) from Takara Bio ...
-
No products found
because this supplier's products are not listed.
Nina Kirstein, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-H4K20me3 (Diagenode, MAb-057-050), or IgG isotype controls for 16h at 4°C ...
-
No products found
because this supplier's products are not listed.
Mohammad M. Sajadi, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.5 μg/mL anti-CD40 mAb (Miltenyi Biotec) and CXCR5 antibody were added ...
-
No products found
because this supplier's products are not listed.
Munevver Cinar, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and NU1025 (PARP inhibitor VI) from Calbiochem. Quick Ligation Kit was purchased from New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Geoffrey K. Herrmann, Y. Whitney Yin,
bioRxiv - Biochemistry 2020
Quote:
... PARP-1 was purified by sequential application to Ni-NTA agarose (Qiagen), HiTrap Heparin HP column (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
... Mab MT57 (Mabtech), were absorbed on plates instead of spike antigen ...
-
No products found
because this supplier's products are not listed.
Katarzyna Olga Rojek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human recombinant VEGF-165 (Stemcell technologies; Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Krisztina Ötvös, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
No products found
because this supplier's products are not listed.
Kostantin Kiianitsa, Nancy Maizels,
bioRxiv - Biochemistry 2020
Quote:
... a rabbit polyclonal raised against recombinant PARP1 (Enzo Life Sciences ALX-210-302-R100; 1:4000 dilution); anti-N-ter-PARP1 ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant mouse IFNγ (Immunotools, #12343537), recombinant mouse IL4 (Immunotools ...
-
No products found
because this supplier's products are not listed.
Kelsey Briggs, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... PARP inhibitors were purchased from Cayman Chemical and diluted in DMSO ...
-
No products found
because this supplier's products are not listed.
Andrea Bernardini, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... TAF10 (3 μg/mL, mouse mAb, 6TA 2B11), TBP (2 μg/mL, mouse mAb, 3TF1 3G3) or SUPT7L (rabbit pAb, Bethyl, A302-803A). A secondary-only control sample was incubated with BPS devoid of primary antibody ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 2M7 mAb isolated from rabbit PBMCs was detected with an HRP-conjugated polyclonal mouse anti-rabbit IgG (Southern Biotech) and all the positive controls were detected with an HRP-conjugated polyclonal goat anti-human IgG (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
David Gonzalez-Perez, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Secondary antibody anti-Rabbit IgG conjugated to HRP (Goat mAb, Vector Laboratories, 1:8,000) was used for detection of proteins using SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Martin Pauli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rabbit polyclonal and mAb anti-Zinc transporter 3 (ZnT3) (Synaptic Systems 197 002 and 197 011, 1:500). Secondary antibodies were used in the following concentrations ...
-
No products found
because this supplier's products are not listed.
Maria Tello-Lafoz, et al.,
bioRxiv - Immunology 2020
Quote:
... ECD-labeled anti-CD56 mAb (Beckman Coulter), BV650-labeled anti-CD3 mAb (clone UCHT1 ...
-
No products found
because this supplier's products are not listed.
Ivan Martinez-Valbuena, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant α-synuclein (rPeptide) was thawed from −80 ◦C storage ...
-
No products found
because this supplier's products are not listed.
Melissa Lim, et al.,
bioRxiv - Biochemistry 2024
Quote:
Recombinant DCAF16 (MyBioSource.com, MBS1375983) (0.1μg/sample ...
-
No products found
because this supplier's products are not listed.
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
No products found
because this supplier's products are not listed.
Tania Christova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant GST (SignalChem #G52-30U) and GST-LTK (SignalChem #L11-11G ...
-
No products found
because this supplier's products are not listed.
Awadalkareem Adam, et al.,
bioRxiv - Immunology 2021
Quote:
... Human recombinant ACE2-Fc-tag (Raybiotech) was then added at 1 μg/mL and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Wai Tuck Soh, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-rat IgG-APC mAb (Jackson ImmunoResearch, West Grove, PA, USA).