-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Amy Rice, et al.,
bioRxiv - Biophysics 2022
Quote:
... 500 µl of a 5 mg/ml β-casein solution was added to a delta-TPG 0.17 mm dish (Bioptechs, Butler, PA) allowed to sit for 10 min to passivate the glass surface ...
-
No products found
because this supplier's products are not listed.
Shoshik Amram, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and p15 (1:500, Assay Biotechnology, #C0287).
-
No products found
because this supplier's products are not listed.
Sean K. Wang, Yunlu Xue, Constance L. Cepko,
bioRxiv - Neuroscience 2021
Quote:
... or 1:500 of anti-SIRPα (QED Bioscience) in blocking solution overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rabbi anti-NeuN (1:500, Biosensis, R-3770-100); guinea pig anti-S100β (1:2,000 ...
-
No products found
because this supplier's products are not listed.
Mihyang Do, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and then the membrane was immunoblotted with primary antibodies as follows: p-PERK (1:1000, Signalway Antibody, Baltimore, MD, USA), PERK (1:1000 ...
-
No products found
because this supplier's products are not listed.
Xiaoling Qiang, et al.,
bioRxiv - Immunology 2020
Quote:
... Fetal bovine serum was from Crystalgen (FBS-500, Commack, NY) and heat-inactivated before use ...
-
No products found
because this supplier's products are not listed.
Steven J. Hersch, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... we amplified the cassette by PCR using Taq (Froggabio T-500) or Q5 (NEB M0491 ...
-
No products found
because this supplier's products are not listed.
Lin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and NKX3.1 (0314, dilution 1:500, Athena Enzyme Systems, Baltimore, MD). Images were taken using a Zeiss microscope (White Plains ...
-
No products found
because this supplier's products are not listed.
Galina A. Gusarova, et al.,
bioRxiv - Physiology 2021
Quote:
... we synthesized nitrilotriacetic acid (NTA) to the N-terminus of TAT (amino acids 48-60, CHI Scientific, Maynard, Mass.). Then ...
-
No products found
because this supplier's products are not listed.
Xiaobo Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and obtained the human FLAG-APLP1(mut9) gene with a Flag tag in the N-terminal synthesized by GENEWIZ Bio ...
-
No products found
because this supplier's products are not listed.
Haris Babačić, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Spectra were then searched in the Galaxy framework using tools from the Galaxy-P project (Boekel et al., 2015; Goecks et al., 2010), including MSGF+ (Kim and Pevzner ...
-
No products found
because this supplier's products are not listed.
Jini Sugatha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-CD8(153-020,Ancell,IF, 1:500, Live imaging, 1:300), anti-CIMPR (ab124767 ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
Cat# MF001003-500,
USD $180/1g, $540/5g
Ask
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Kelly MT Shekiro, et al.,
bioRxiv - Bioengineering 2020
Quote:
... broadband UV light (λ = 350-500 nm, I ∼ 70 mW/cm2; Oriel Instruments) for 60 sec to allow for polymerization in the regions not shaded by the photomask ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Philippe Marullo, et al.,
bioRxiv - Genetics 2019
Quote:
... Glucose and Fructose consumed were estimated by enzymatic assay using the kit n° 10139106035 according to manufacturer protocol (R-Biopharm, Germany) and the RS (Residual Sugars ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Eric M. Strohm, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cantilever D with nominal spring constant of 0.03 N/m) were functionalized using 10 µm radius spherical polystyrene beads (Phosphorex Inc. Hopkinton, MA). A contact-based thermal tune method was applied to determine the precise spring constants ...
-
No products found
because this supplier's products are not listed.
Mari Akiyama,
bioRxiv - Cell Biology 2024
Quote:
... the antibody of α-SMA (1:500; ARG66381; Arigo Biolaboratories Corp., Hsinchu City, Taiwan) was used ...
-
No products found
because this supplier's products are not listed.
Jae Won Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1H-NMR spectra were recorded on a JNM-ECA-500 spectrometer (JEOL Co., Tokyo, Japan) at 500 MHz ...
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... 10 μg/mL ciprofloxacin (Genhunter), and either 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Beatriz E. Nielsen, Christopher P. Ford,
bioRxiv - Neuroscience 2023
Quote:
... but further filtered to 500 Hz with the gain increased two-fold (FLA-01, Cygnus Technologies). Then the signal was acquired using a data acquisition device (ITC-18 ...
-
No products found
because this supplier's products are not listed.
Leticia R. Q. Souza, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the primary antibodies [Non-structural protein 1 from ZIKV (NS1, 1:500, BioFront Technologies, BF1225-06;), Class III β-tubulin (TuJ3 ...
-
No products found
because this supplier's products are not listed.
Rachel Sim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Organs were sectioned to 50 μm using a VF-500-0Z microtome (Precisionary Instruments LLC, US).
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
Tianzi Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 μg/mL ECGS (Cell Biologics), 50 ug/mL heparin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Nam-Kyung Lee, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 100 μg/ml penicillin/streptomycin (Axenia BioLogix) at 37°C in a humidified atmosphere containing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
M. Hülsemann, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The fluorescence emission spectra were obtained by exciting the cell suspension in a 500 μL quartz cuvette (Starna Cells, Atascadero, CA, USA) at 433 nm ...
-
No products found
because this supplier's products are not listed.
Oscar R. Benavides, et al.,
bioRxiv - Biophysics 2023
Quote:
... in a 10 mL rotating wall vessel (RWV) bioreactor (Synthecon) and fixed with neutral buffered formalin ...
-
No products found
because this supplier's products are not listed.
Drew S. Tack, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Frozen glycerol stocks were used to inoculate initial cultures in enriched M9 media in 96 well plates (500 μL culture volume per well in clear, square-well assay plates, Brooks Life Sciences 4ti-0255). Cultures were grown overnight at 37°C shaking at 1300 rpm ...
-
No products found
because this supplier's products are not listed.
KM Hudock, et al.,
bioRxiv - Immunology 2022
Quote:
... 100mU/ml human NE protein (Athens Research & Technology #16-14-051200, ART), 100μU/ml human PR3 protein (ART #16-14-161820 ...
-
No products found
because this supplier's products are not listed.
Marta Bicka, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The axoneme solution at 3.6 mg/mL was mixed with 5 (Cytodiagnostics) or 10 (Aurion ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Tatsuya Ikuta, et al.,
bioRxiv - Biophysics 2020
Quote:
The purified protein was concentrated to 10 mg /mL and mixed with monoolein (Nu-Chek Prep) in a 2:3 protein to lipid ratio (w/w) ...
-
No products found
because this supplier's products are not listed.
Richard C. Chang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Chromatin samples were prepared by sonicating in 0.5 mL thin-walled polymerase chain reaction tubes (BrandTech, CT) using a QSonica Q800R2 (QSonica ...
-
No products found
because this supplier's products are not listed.
Zijing Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... Bees were then mounted to modified 2.0-mL centrifuge tubes using Parafilm M (Bemis; Sheboygan Falls, WI, USA), and they could only move their heads and propodeum for antennae sanitation ...
-
No products found
because this supplier's products are not listed.
Blasi Maria, et al.,
bioRxiv - Immunology 2020
Quote:
... Plates were then incubated with 2 μg/ml biotinylated rabbit anti-human IFN-γ (U-CyTech biosciences, Utrecht, The Netherlands) for 2 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Marta Napiorkowska, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 30 min) and the cell-free extract was loaded onto column packed with 2 mL Super Ni-NTA matrix (Protein Ark) pre-equilibrated with 3 column volumes (CV ...