-
No products found
because this supplier's products are not listed.
Mitchell Delemeester, et al.,
bioRxiv - Bioengineering 2024
Quote:
Bi2O3 NPs (99% purity) were purchased from American Elements. Polycaprolactone Filament (Facilan ™PCL 100) ...
-
No products found
because this supplier's products are not listed.
Verena Haage, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 ng/mL CD200 (Bon Opus Biosciences) and 100 ng/mL CX3CL1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
D. Hoving, et al.,
bioRxiv - Immunology 2023
Quote:
... serum from a donor 3 weeks post-PCV13 vaccination was diluted 1:100 in 0.5% BSA in PBS with 10µg/mL cell wall PS multi (CWPS-multi; SSI Diagnostica; 68866 ...
-
No products found
because this supplier's products are not listed.
Shalini Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The N- and C-peptides were labeled with maleimide-derivatized DY549P1 (Dyomics), DY649P1 (Dyomics) ...
-
No products found
because this supplier's products are not listed.
Leila Revollo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti p-VLK (Y64) raised against epitope GRGELARQIRERYEEVQRYSRG phosphorylated at Y64 of mouse VLK (Abfrontier), anti cytoplasmic actin (Milipore Sigma ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Tabitha E. Hoornweg, et al.,
bioRxiv - Microbiology 2020
Quote:
... 100 µl/well TMB Substrate (Surmodics) was added ...
-
No products found
because this supplier's products are not listed.
Fumiyuki Hatanaka, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1:100 (MCA-1B7, EnCor Biotechnology); anti-ChAT ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... slides were fixed in 100% acetone and stained with anti-HCV core antibody (1:100, clone B2, Anogen), and subsequently with the AlexaFluor-488-conjugated anti-mouse antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Philippe Marullo, et al.,
bioRxiv - Genetics 2019
Quote:
... Glucose and Fructose consumed were estimated by enzymatic assay using the kit n° 10139106035 according to manufacturer protocol (R-Biopharm, Germany) and the RS (Residual Sugars ...
-
No products found
because this supplier's products are not listed.
Abdallah W. Abdelhady, et al.,
bioRxiv - Biophysics 2023
Quote:
... oocytes were placed with as little surrounding vitrification solution as possible onto one of three polymer sample supports (Figure S2): a 10 μm thick cryocrystallography sample support with a 100 μm aperture (MicroLoop LD 100, MiTeGen, Ithaca, NY), a flat ...
-
No products found
because this supplier's products are not listed.
Xiuping Sun, Bing Chen, Zhiwei Song, Lei Lu,
bioRxiv - Cell Biology 2021
Quote:
... Bafilomycin A1 (working concentration: 100 nM) was from Chemscene.
-
No products found
because this supplier's products are not listed.
Marion Wargnies, et al.,
bioRxiv - Microbiology 2020
Quote:
... the rabbit anti-FRDm2 (aFRDm2, 1:100, produced by Proteogenix from the EISKSVFPDASLGV and ELGHNKSNIVTL peptides) ...
-
No products found
because this supplier's products are not listed.
Rajashree A. Deshpande, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Elisa Tonoli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 30 μg/ml TG2 (Zedira) in ACSF was perfused until plateau of the response was reached ...
-
No products found
because this supplier's products are not listed.
Mayra Martinez-Lopez, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Mitomycin C(0.5mg/mL; Medac)/L-PBS or Mitomycin C/L-Clodronate were injected intratumorally and xenografts were placed immediately in clean E3 medium ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... We further compared neurons cultured in patterning versus maturation medium using 5 μl/ml BDNF and 5 μl/ml GDNF slow release PLGA microbeads (StemCultures; 5 ng/ml steady-state concentrations) at two time points ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with a 0.75-mm-thick flow gasket (Bioptechs, 1907-100; DIE# F18524) was used ...
-
No products found
because this supplier's products are not listed.
Clara Lambert, et al.,
bioRxiv - Microbiology 2023
Quote:
... essentially composed of C18:1Δ9 or 100 μM C17:1 (Larodan, Sweden). Overnight cultures were diluted to an OD600nm = 0.05 and grown in the indicated medium to the exponential phase (OD600nm comprised between 0.4 and 0.5).
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1 µg/mL of upadacitinib (MedKoo Biosciences), was treated 1 h prior to poly I:C transfection ...
-
No products found
because this supplier's products are not listed.
Xin-Zi Tang, et al.,
bioRxiv - Immunology 2022
Quote:
... mice were first sensitized by intraperitoneal (i.p.) injections with 100 μg Endograde OVA (Hyglos) mixed with 100 μl alum (Alhydrogel ...
-
No products found
because this supplier's products are not listed.
Declan J. Lafferty, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The tissue was filtered using a 100 µM cell strainer (C4100, MTC Bio, USA) and washed with 50 mL sterile deionized water ...
-
No products found
because this supplier's products are not listed.
Miguel Pineda, et al.,
bioRxiv - Immunology 2021
Quote:
... Collagen-Induced Arthritis (CIA) was induced with bovine type II Collagen (MD Biosciences, 100 mg), injected intradermally (day 0 ...
-
No products found
because this supplier's products are not listed.
Albert S. W. Kang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Purification from excess OsBp was done with spin columns (TC-100 FC from TrimGen Corporation) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Myrthe A.J. Smits, et al.,
bioRxiv - Cell Biology 2023
Quote:
... All slides were subsequently washed in TBS and incubated with 100 μl Superblock (Scytek Laboratories) at room temperature for one hour ...
-
No products found
because this supplier's products are not listed.
Avery Chambers, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... PCR amplification was verified on a 1% agarose gel with a 100 bp ladder (Froggabio) for reference.
-
No products found
because this supplier's products are not listed.
Atomu Yamaguchi, et al.,
bioRxiv - Immunology 2023
Quote:
... the pellet was processed with 100 μL of PROPREP reagent (iNtRON Biotechnology Co., Ltd. Japan), followed by incubation on ice for 20 min ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Nathan M. Belliveau, et al.,
bioRxiv - Cell Biology 2022
Quote:
... resuspended in 10 mL PolymorphPrep (Cosmo Bio USA #AXS1114683) and added to the bottom of a 50 mL conical tube ...
-
No products found
because this supplier's products are not listed.
Subash Godar, et al.,
bioRxiv - Biophysics 2021
Quote:
... We prepared a 100 – 150 μm deep motility chamber constructed from parafilm (PM-999, Bemis, WI) sandwiched between easy cleaned [104] glass slides and No ...
-
No products found
because this supplier's products are not listed.
Oscar R. Benavides, et al.,
bioRxiv - Biophysics 2023
Quote:
... in a 10 mL rotating wall vessel (RWV) bioreactor (Synthecon) and fixed with neutral buffered formalin ...
-
No products found
because this supplier's products are not listed.
Joseph H. Chapman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The plate was sealed with Avant ThermalSeal optically clear polyester RT-PCR film (MIDSCI TS-RT2-100), briefly spun down ...
-
No products found
because this supplier's products are not listed.
Gamaliel Junren Ma, et al.,
bioRxiv - Biophysics 2019
Quote:
... UK) and 100-nm diameter silica nanoparticles (catalog no. SISN100) were obtained from nanoComposix (San Diego, CA, USA).
-
No products found
because this supplier's products are not listed.
Teppei Goto, et al.,
bioRxiv - Neuroscience 2023
Quote:
... an Alzet osmotic minipump (model 1007D; flow rate 0.5 μL/hour, 100 μL capacity, Durect, Cupertino, CA, USA) filled with 6.1 mg/mL CNO was surgically implanted into the subcutaneous cavity of the mice in the evening on postnatal day 36 ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Haugh, et al.,
bioRxiv - Microbiology 2020
Quote:
... or permeabilized with PBS containing 0.2% Triton X-100 (for stains of intracellular proteins) and treated with Fc receptor blocker (Innovex Biosciences), Richmond ...
-
No products found
because this supplier's products are not listed.
Yu-An Kuo, et al.,
bioRxiv - Bioengineering 2021
Quote:
We quantified NCB fluorescence using a fluorometer (FluoroMax-4, Horiba) and a 100 µl quartz cuvette (16.100F-Q-10/Z15, Starna Cells). Both the excitation and emission wavelength scan ranges were set to be from 400 nm to 800 nm using 5 nm slit size ...
-
No products found
because this supplier's products are not listed.
Matthias Hecht, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 50,000 cells were resuspended in 100 µl prewarmed DMEM without FBS and transferred into a 8 µM PET tissue culture plate insert (BrandTech). The insert was placed into a well of a 24 well cell culture plate containing 700 µl prewarmed DMEM supplemented with 10 % FBS ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Pierre Bensidoun, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 100-μl cell suspension was added to a 96-well glass-bottom plate (MGB096-1-2-LG-L; Brooks Life Science Systems) previously coated with concanavalin A (Con A ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...