-
No products found
because this supplier's products are not listed.
Like Shen, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The K+ concentration in the xylem sap and phloem exudate were determined using inductively coupled plasma/optical emission spectrometry (PerkinElmer, Waltham, USA).
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Karl Kasper, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 50 μl unprocessed xylem sap were transferred to a 2 mL reaction tube (Eppendorf) and 200 μL extraction medium (methanol ...
-
No products found
because this supplier's products are not listed.
Francine Bittencourt Schiffler, et al.,
bioRxiv - Microbiology 2023
Quote:
... veterinarians from the SAP/UFRuralRJ further tested lung samples of necropsied NPs by Immunohistochemistry (IHC) using an Anti-Sars-CoV Nucleocapsid Protein (Novus Biologicals® ...
-
Cat# HY-P1339,
inquire
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Rosy P. Cárdenas-Sandoval, et al.,
bioRxiv - Bioengineering 2021
Quote:
Soft cantilevers T R400P B (Olympus, Japan) with a nominal spring constant of 0.09 N/m ...
-
No products found
because this supplier's products are not listed.
Yunfan Bai, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 μL of IS B (Avanti Polar Lipids Inc.) containing 1.0 nmol monoacylglycerol (MG ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Seong Su Kang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... MAO-B (GeneTex), MAO-A (GE healthcare) ...
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Michel G. Tremblay, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and transferred to a Biodyne B membrane (Pall). The membrane was UV cross-linked at 70 J/cm2 ...
-
No products found
because this supplier's products are not listed.
Paul V. Hickner, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and Sobral 1S-B and Jacobina-A (3MαH).
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Rachael Deis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and mouse anti-b-Actin antibody (Jackson ImmunoResearch, #111-035-003). Membranes were washed 3x for 10min in 1X TBST and incubated with the secondary antibody ...
-
No products found
because this supplier's products are not listed.
Swarnabh Bhattacharya, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Rho Activator II (Cytoskeleton, CN03-B), or Verteporfin (Sigma ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Variant Lineage B.1.1.7 (S1N-C52Hg, Acrobiosystems), HA Recombinant Influenza A Virus Protein ...
-
No products found
because this supplier's products are not listed.
Tejas R. Karhadkar, et al.,
bioRxiv - Immunology 2020
Quote:
Purified human SAP (30C-CP1104LY) was purchased from Fitzgerald Industries (Acton ...
-
No products found
because this supplier's products are not listed.
Víctor Hugo Jarquín-Díaz, et al.,
bioRxiv - Microbiology 2019
Quote:
All PCR products with the expected size were purified using the SAP-Exo Kit (Jena Bioscience GmbH, Jena, Germany) and Sanger sequenced from both directions by LGC Genomics (Berlin ...
-
No products found
because this supplier's products are not listed.
Joana Carvalho, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The contrast sensitivity at several locations of the VF was measured using SAP in particular HFA (Carl Zeiss Meditec, Jena, Germany) using the 24-2 or 30-2 grid and the Swedish Interactive Threshold Algorithm (SITA ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Amy Lam, et al.,
bioRxiv - Biophysics 2021
Quote:
... Octadecyl rhodamine B chloride (R18) dye was purchased from Biotium, Inc ...
-
No products found
because this supplier's products are not listed.
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-orexin (1:500, T4074, Peninsula Laboratories, San Carlos, CA), mouse anti-SMI32 (NEFH ...
-
No products found
because this supplier's products are not listed.
Daniela Calvigioni, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti-Orexin A (1:1000 Synaptic system, Cat#389 004); chicken anti-V5 (V5 ...
-
No products found
because this supplier's products are not listed.
Alice Braga, et al.,
bioRxiv - Neuroscience 2024
Quote:
... To visualize orexin-expressing neurons for electrophysiological recordings oMCT2 KD and control mice received AAV9-CAG-DIO-mCherry virus (VB1326, Vector Biolabs). 7 weeks old female and male Ai14 mice have been bilaterally injected with AAV-PhP.eB-GFAP(0.7)-EGFP-T2A-iCre to test for viral transduction specificity.
-
No products found
because this supplier's products are not listed.
John B. Issa, et al.,
bioRxiv - Neuroscience 2023
Quote:
Widefield images were taken with a custom-built fluorescence microscope with a GFP filter cube through a 2X objective (TL2X-SAP, Thorlabs) and captured with a scientific CMOS camera (Prime BSI Express, Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Geeisy Cid, et al.,
bioRxiv - Physiology 2022
Quote:
... Plant tissue or xylem sap were derivatized using an NMR-purified fluorescing reagent AQC (6-aminoQuinolyl-N hydroxysuccinimidyl carbamate) (BIOSYNTH AG, Switzerland). Three mg of AQC were dissolved in 1 ml acetonitrile and incubated for 10 min at 55°C ...
-
No products found
because this supplier's products are not listed.
Karl Kasper, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Fifty μl xylem sap and 50 μl Coomassie Plus were mixed in a flat bottom 96 well micro titer plate (Greiner AG, Kremsmünster, Austria) and incubated for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Namita Chatterjee, et al.,
bioRxiv - Cell Biology 2020
Quote:
... ERN1 (Cat: SR301457A&B, Origene), siRNA Negative Control (Cat ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Lisa C Green, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and stained with Picrosirius Solution B (Polysciences, 24901B) for one hour at room temp ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Manuel Albanese, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human primary B cells were prepared from adenoidal mononuclear cells by Ficoll Hypaque (PAN Biotech) gradient centrifugation (as described in Albanese et al. ...
-
No products found
because this supplier's products are not listed.
Aurora Alvarez-Buylla, et al.,
bioRxiv - Physiology 2023
Quote:
... we used the Zymo RiboFree Total RNA Library Prep kit (R3003-B, Zymo Research, Irvine, CA) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Andreia R. Fernandes, et al.,
bioRxiv - Cell Biology 2021
Quote:
actin depolymerizer Latrunculin B (Focus Biomolecules) and actin stabilizer Jasplakinolide (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Aric N. Brown, et al.,
bioRxiv - Microbiology 2023
Quote:
... Polymyxin B (RPI Lot# 85594-90055) was added to cells triplicate96-well plates at a final concentration of 5.0µg/mL (C ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
Evelien Eenjes, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 10 μg/mL PureCol (Advanced Biomatrix; 5005-B) for 2 hrs at 37°C ...
-
No products found
because this supplier's products are not listed.
Courtney M. Smith, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Raji B cells were obtained from American Type Culture Collection and were cultured in RPMI-1640 media supplemented with 10% FCS ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...