-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Dyah W. Karjosukarso, et al.,
bioRxiv - Systems Biology 2023
Quote:
... pH 7.4), followed by secondary antibody anti-mouse IRDye 800 (1:4000, LiCor Biosciences) and DR (1:4000, Biostatus) for 1 hour at RT ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Probe DNA (mouse rDNA BAC clone RP23-225M6, Empire genomics) was mixed with Hybridization buffer (50% formamide ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse embryonic fibroblasts (MEFs) were cultured using DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
No products found
because this supplier's products are not listed.
Chen Jiang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Primary mouse keratinocytes were kept in culture medium (CnT-07; Cellntec) at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Zhenyue Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... each mouse was administrated the Sulfo-Cyanin-5.5-carboxylic-acid (Lumiprobe GmbH, Germany) fluorescent dye solution in PBS (50 µl ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Karl A. Johnson, et al.,
bioRxiv - Biophysics 2020
Quote:
... we imaged a GFP labelled mouse brain sample acquired from SunJin Lab (Hsinchu City, Taiwan). This sample is a 250um thick coronal section which was cleared and mounted by SunJin Lab using the RapiClear 1.52 reagent.
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
CP Profaci, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Three hours after CNO injection the mice were live-decapitated using a mouse decapitator (LabScientific, XM-801) and brain endothelial cells were isolated for RNA sequencing.
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-ZIKV IgG (XPressBio, Frederick, MD, USA) at baseline ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
Recombinant Mouse IMPDH2 full length or partial length protein was expressed.
Cat# IMPDH2-8199M,
20ug , USD $798
Ask
Daniela Esser, et al.,
bioRxiv - Neuroscience 2023
Quote:
... male and female) were immunized twice with Recombinant Mouse CNTNAP (>95% purity) and LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
Sahil Shah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Then the promoter activities were tested in C20 human microglia and SIM-A9 mouse microglia cell lines using Glial-Mag kit (OZ Bioscience, Cat # GL002500). The cells were cultured under standard conditions and seeded into 96-well plates at a density of 3.0×104/100 μl ...
-
No products found
because this supplier's products are not listed.
B. van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... was used for MDA-MB-436 and mouse targeting shEXO1 (see Table 1 for sequence, cloned in pRSITEP-U6Tet-sh-EF1-TetRep-2A-Puro from Cellecta Catalog #: SVSHU6T16-L) was used for MEFs.
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Hanah M. Georges, et al.,
bioRxiv - Immunology 2023
Quote:
Human and mouse FMs were homogenized using a beadbug microtube homogenizer with microtubes pre-filled with high impact zirconium beads (Benchmark Scientific; Sayreville, NJ) as previously described (6) ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).