-
No products found
because this supplier's products are not listed.
Samuel X. Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Brain slices (2 mm) were consecutively sectioned coronally using a stainless-steel mouse brain matrix (Roboz Surgical Instrument Co. ...
-
No products found
because this supplier's products are not listed.
Ritu Bohat, et al.,
bioRxiv - Immunology 2023
Quote:
Experimental mice were individually housed in mouse metabolic cages (#MM030505-10R, Lenderking caging products, Millersville, MD) for 24 hours to collect urine samples ...
-
No products found
because this supplier's products are not listed.
Aminata P. Coulibaly, et al.,
bioRxiv - Neuroscience 2019
Quote:
The arterial tree of each mouse was labeled using the vascular dye Microfil (Flow Tech, Carver, MA), and the cross-sectional MCA diameter was measured ...
-
No products found
because this supplier's products are not listed.
Julie Wells, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The left lung lobe of each mouse was fixed in neutral buffered formalin (Labchem, Inc. Pittsburgh, PA) overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Patricia Aguilar-Calvo, et al.,
bioRxiv - Pathology 2023
Quote:
... full length recombinant mouse PrP (23-230) generated in E.coli was first conjugated to deferoxamine-maleimide (Macrocyclics) to produce deferoxamine-conjugated PrPC (DFO-PrPC) ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
CP Profaci, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Three hours after CNO injection the mice were live-decapitated using a mouse decapitator (LabScientific, XM-801) and brain endothelial cells were isolated for RNA sequencing.
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-ZIKV IgG (XPressBio, Frederick, MD, USA) at baseline ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... incubated with diluted mouse serum (1:8 or 1:16 dilution) and biotinylated detection antibodies (mAB2:1, UmanDiagnostics). Upon adding streptavidin-conjugated β-galactosidase (Quanterix) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
LC Laboratories' Product Number P-7022 - Ponatinib, Free Base (AP-24534, Iclusig, CAS...
Cat# P-7022, SKU# P-7022_200mg,
200 mg, $107.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Szi Kay Leung, et al.,
bioRxiv - Neuroscience 2023
Quote:
Raw reads were processed and de-multiplexed with Iso-Seq (v3), aligned to the mouse reference genome (mm10, GENCODE) using pbmm246 (v1.10.0, a Minimap2 wrapper adapted for PacBio data ...
-
No products found
because this supplier's products are not listed.
Annemarie Lang, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a mouse double swing (Datesand Group, Bredbury, United Kingdom) and a Shepherd Shack (Shepherd Specialty Papers, Milford, NJ) where the entrance area was enlarged to avoid injuries due to the external fixator (57) ...
-
No products found
because this supplier's products are not listed.
Thomas Germe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... for 10 min before incubating at 4°C overnight with monoclonal antibody (either anti-GyrA-CTD – 4D3 or anti-GyrB-CTD – 9G8; a gift from Alison Howells, Inspiralis) diluted 1/1000 in TBS-T 5% milk ...
-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Henriette Frikke-Schmidt, et al.,
bioRxiv - Physiology 2020
Quote:
The heating pad with the mouse was then placed on top of the H101A ProScan motorized stage (Prior Scientific Instruments Ltd ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Ainhoa Martínez-Pizarro, et al.,
bioRxiv - Pathology 2023
Quote:
... cDNA was obtained by retrotranscription of 500 ng of total RNA from mouse liver or HepG2 cells using NZY First-Strand cDNA synthesis kit (NZYTech). Pah ...
-
No products found
because this supplier's products are not listed.
Mengjie Li, et al.,
bioRxiv - Microbiology 2024
Quote:
Total RNA was extracted from mouse lung tissue using an RNA extraction kit according to the manufacturer’s instructions (BioMiGA, China). All materials required for the experiment were treated with DPEC water to remove RNA enzyme (BioMiGA ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Chafen Lu, et al.,
bioRxiv - Microbiology 2019
Quote:
... Secondary antibodies were rabbit polyclonal anti-His (Delta Biolabs), Horseradish peroxidase (HRP)-anti-rabbit and HRP-anti-mouse IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Yuka Takemon, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Mice were fully genotyped for 78,000 SNPs using the GeneSeek Mega Mouse Universal Genotyping Array (MegaMUGA) (Neogen Genomics, Lincon, NE, USA) [43] ...
-
No products found
because this supplier's products are not listed.
Jessica Spring, et al.,
bioRxiv - Microbiology 2022
Quote:
... single cell suspensions (with red blood cells) from RL-MuLV infected mouse spleens were serially diluted in Clicks medium (Irvine scientific) and were subjected to the infectious center assay (Rowe et al. ...
-
No products found
because this supplier's products are not listed.
Mathew Clement, et al.,
bioRxiv - Immunology 2020
Quote:
The α and β chains of the MEL5 TCR were engineered to contain mouse constant domains [20] and cloned into a single pSF-Lenti-EF1α lentiviral vector (Oxford Genetics) separated by an internal ribosomal entry site (IRES ...
-
Recombinant Mouse IMPDH2 full length or partial length protein was expressed.
Cat# IMPDH2-8199M,
20ug , USD $798
Ask
Daniela Esser, et al.,
bioRxiv - Neuroscience 2023
Quote:
... male and female) were immunized twice with Recombinant Mouse CNTNAP (>95% purity) and LGI1 protein (>90% purity) (Cntnap2-3316M, LGI1-9069M, Creative Biomart) emulsified in Complete Freund’s Adjuvant (CFA ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Kaushik Bhattacharya, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Lysates of cells or mouse tissues (20-100 μg) were subjected to SDS-PAGE and transferred onto a nitrocellulose membrane (GVS Life Science) with a wet blot transfer system (VWR) ...
-
No products found
because this supplier's products are not listed.
Malene E Lindholm, et al.,
bioRxiv - Genetics 2020
Quote:
Neonatal rat ventricular myocytes (NRVMs) were isolated from newly born rats using the neonatal rat/mouse cardiomyocyte isolation protocol from Cellutron (nc-6031) according to the specifications from the manufacturer ...
-
HIF-PHD inhibitor
Sold for research purposes only.
Cat# 3615.0, SKU# 3615-50 mg,
50mg, US $462.00 / EA, EURO, €420 / EA
Ask
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
B. van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... was used for MDA-MB-436 and mouse targeting shEXO1 (see Table 1 for sequence, cloned in pRSITEP-U6Tet-sh-EF1-TetRep-2A-Puro from Cellecta Catalog #: SVSHU6T16-L) was used for MEFs.
-
No products found
because this supplier's products are not listed.
Marcos Moreno-Aguilera, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... More than 90 million reads were obtained per sample, which were aligned to the mm10 mouse genome using HISAT2 (Kim et al, 2015) in the Galaxy platform (Boekel et al, 2015). Assignment to transcriptional units ...
-
No products found
because this supplier's products are not listed.
Domenico Viola, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with 100 μl of the D-Luciferin solution at a final dose of 3 mg/20 g mouse body weight (Biosynth, Cat. No. L-82220) and then gas-anaesthetized with isoflurane (Faulding Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Anna Tasegian, et al.,
bioRxiv - Physiology 2024
Quote:
... a 50% conditioned media (1:1 dilution in advanced D-MEM/F12 base media) was generated from genetically modified L-WRN mouse fibroblast cell line (ATCC, #CLR-3276™, ATCC, LGC Standards, Middlesex, UK) cultured in advanced D-MEM/F12 (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Hannah A. Pizzato, et al.,
bioRxiv - Immunology 2023
Quote:
CHO cells were incubated with 1µg/mL anti-CHO antibody (Cygnus Technologies) for 30min at 4°C ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Lucy Ngo, et al.,
bioRxiv - Systems Biology 2019
Quote:
▪ Lint free cotton swab with anti-static handle (Puritan Medical Products, SKU#: 876-PPC)
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Minxiao Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies used for co-staining were rabbit-anti-Gramd2 (1:100, ATLAS biological, CAS #HPA 029435), rabbit-anti-Sftpc (1:300 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Tomozumi Imamichi, et al.,
bioRxiv - Microbiology 2022
Quote:
... and anti-protease antibody (Cat# ab211627 Abcam, Cat# SKU: 65-018, As One International, Santa Clara, CA, USA), Protein bands were detected by using the ECL Prime Western Blotting Detection Reagent (MiliporeSigma ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).