-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Membranes with protein samples subsequently reacted with anti-ACTB (1:5000, pAb, ZEN BIO, China), anti-SCRN2 (1:500 ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... CA) along with 1:1000 dilution of Anti-Membrane Protein (2019-nCoV) Polyclonal Antibody (NCV-M-005, eEnzyme, Gaithersburg, MD) and then immunoprobed with appropriate infrared secondary antibody ...
-
No products found
because this supplier's products are not listed.
Peiyu Xu, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The protein complex was assembled on membrane by adding 100 μM rotigotine (TargetMol) and 10 μg/mL Nb35 ...
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 µg/mouse of IL-15 (Shenandoah Biotech) was injected three times per week with an intraperitoneal injection (ip) ...
-
No products found
because this supplier's products are not listed.
Zachary JW Easton, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... PVDF membranes were blocked in 5% dry-milk protein or 5% Bovine Serum Albumin (BSA, BioShop Canada Inc., Burlington, Canada) and membranes were incubated overnight at 4℃ with respective antibody solutions (Supplementary Table 2) ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Dennis S. Metselaar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... glial fibrillary acidic protein (GFAP) (1:500; BT46-5002–04, BioTrend), S100 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Basia Gabela-Zuniga, et al.,
bioRxiv - Bioengineering 2024
Quote:
... both sides of the electrospun membrane were collagen coated with type 1 bovine collagen (Advanced Biomatrix; Carlsbad, CA) overnight at 60 µg/mL.
-
No products found
because this supplier's products are not listed.
Miho Matsuda, Chih-Wen Chu, Sergei Y. Sokol,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-DYKDDDDK mAb clone 2H8 (Cosmo Bio USA, #KAL- K0602, 1:1000) and mouse anti-GFP mAb clone B2 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Xuan Yang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Mouse cryopreserved hepatocytes were supplied by BioIVT (lot ZPG, pooled male CD-1). Vials of cryopreserved hepatocytes were removed from storage and thawed in a 37°C water bath with gently shaking ...
-
No products found
because this supplier's products are not listed.
Mariano Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
Blots were incubated with antibodies (1/3000 dilution) purified on G-protein (Proteogenix, France), followed by horseradish peroxidase-conjugated (HRP ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Sun, Linxi Cheng, Yuhua Sun,
bioRxiv - Developmental Biology 2021
Quote:
... Then the membranes were incubated with a HRP-conjugated goat anti-rabbit IgG (GtxRb-003-DHRPX, ImmunoReagents, 1: 5000), a HRP-linked anti-mouse IgG (7076S ...
-
No products found
because this supplier's products are not listed.
Walker D. Short, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were seeded as monolayers on silicone membranes in 6-well plates (BioFlex membrane Culture Plate, Flexcell Corp.). Per the manufacturer’s material properties specification ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... and blocked with ELISA diluent (5% nonfat milk [LabScientific, Danvers, MA, USA] in PBS-T) for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sebastian Pöhl, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was then purified using zinc-affinity chromatography using a 1 mL Zn-NTA column (Cube Biotech) equilibrated with lysis buffer containing 5 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Bastien Casu, et al.,
bioRxiv - Microbiology 2022
Quote:
... Streptomyces cells were mixed with 10 nm Protein A conjugated colloidal gold particles (1:10 v/v, Cytodiagnostics) and 4 µl of the mixture was applied to a glow-discharged holey-carbon copper EM grid (R2/1 or R2/2 ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Gabriella Collu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The membranes were gently resuspended using an Ultra-turrax dispersing machine (IKA, USA) in solubilization buffer (50 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Aurélie Flaive, Dimitri Ryczko,
bioRxiv - Neuroscience 2020
Quote:
... The neuron membrane was approached with a pipette using a motorized micromanipulator (Sutter instruments). A gigaseal was established by removing the positive pressure ...
-
No products found
because this supplier's products are not listed.
Ana Bura, Antonija Jurak Begonja,
bioRxiv - Cell Biology 2022
Quote:
... Membranes were blocked for 45 min in BSA/TBST (3% bovine serum albumin [Pan Biotech, P06-1391100]/Tris ...
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wilton T. Snead, et al.,
bioRxiv - Biophysics 2021
Quote:
... Protein solutions were loaded into glass-bottom imaging chambers (Grace Bio-Labs). To prevent protein adsorption to the imaging surface ...
-
No products found
because this supplier's products are not listed.
Shane Miersch, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Fifty micrograms of protein were injected onto a TSKgel BioAssist G3SWxl (Tosoh) fitted with a guard column using an NGC chromatography system and a C96 autosampler (Biorad) ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μM 1-NM-PP1 (Toronto Research Chemicals; A603003) was added into one of the cultures to inactivate Cdc2 (Cdk1 ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.