-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Inbar Segal, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
No products found
because this supplier's products are not listed.
Meng-Sheng Lee, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 0.5mM UDP-MurNAc (Chiralix), 5mM ATP ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Malika Aid, et al.,
bioRxiv - Microbiology 2021
Quote:
... at 1:1000 detection using Mouse Polink-2 HRP (GBI Labs Cat. No. D37-110). Staining for MPO and Mx1 IHC was performed as previously described using a Biocare intelliPATH autostainer ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Gregory C. Howard, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cultures were pulsed with 1 mM 2’-azido-2’-deoxycytidine (Biosynth), or 0.1% DMSO for an unlabeled control ...
-
Cat# H1K237-2,
USD $495.0/kit
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
Cat# G209,
USD $10.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse GAPDH (5G4MaB6C5, HyTest; 1:20.000 WB), Alexa Fluor 488 Phalloidin (Invitrrogen ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Anti-mouse TFAM (1:1000; PhosphoSolutions 2001-TFAM), Tom20 (1:1000 ...
-
Gliadin ELISA Kit
Cat# EGLD-100,
1.0 kit, 96 tests, USD $519.0
Ask
Yehezqel Elyahu, et al.,
bioRxiv - Immunology 2024
Quote:
... The levels of AST and ALT in murine serum were measured using EnzyChrom™ ELISA kits for AST and ALT (BioAssay Systems) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Katrin Schrenk-Siemens, et al.,
bioRxiv - Neuroscience 2019
Quote:
... LTMRs or mouse DRG neurons were loaded with FURA-2 AM (10 μg/ml, HelloBio) or Cal520 AM (5 μM ...
-
No products found
because this supplier's products are not listed.
Cambrian Y. Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 2 μM Cy3 azide (Click Chemistry Tools AZ119-1), and 100 mM ascorbic acid freshly prepared and diluted in Gomori buffer (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in which animals received subcutaneous injections of bisphosphonate ibandronate sodium (2 mg/kg/mouse, APEXBIO, B1772) twice per week (on Mondays and Thursdays) ...
-
No products found
because this supplier's products are not listed.
Andrea Salm, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 2-hydroxy-3-methylanthraquinone (13) and 2-hydroxy-1-methylanthraquinone (14) were obtained from Toronto Research Chemical, ON ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Mustapha Dibbasey, Terry Gaymes,
bioRxiv - Cancer Biology 2021
Quote:
... Both HR plasmids (dl-1 and dl-2) and positive control plasmid were supplied with the Norgen’s Homologous Recombination kit (Norgen Biotek Corp., Thorold, ON, Canada). For each transfection ...
-
No products found
because this supplier's products are not listed.
Jesyin Lai, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... Extracellular neurophysiological activity was recorded using 1-2 tungsten microelectrodes (FHC) or a 64-channel electrode array (Masmanidis Lab ...
-
No products found
because this supplier's products are not listed.
Meagan Hamblin, et al.,
bioRxiv - Microbiology 2023
Quote:
... slides were first stained with 1:200 Mouse monoclonal LAMP-1 (DSHB) and 1:1000 Chicken anti-Salmonella (Aves Labs) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Angelo Chora, et al.,
bioRxiv - Immunology 2020
Quote:
Comet assay was performed in THP-1 cells (ATCC catalog number TIB-202) using the CometAssay Kit 25 x 2 well slides (Trevigen catalog number 4250-050-K). A step-by-step protocol detailing the exact procedures and all the materials used is available online from Protocol Exchange (Alkaline Comet Assay using the monocytic cell line THP-1 ...
-
No products found
because this supplier's products are not listed.
S. ter Horst, et al.,
bioRxiv - Microbiology 2022
Quote:
2’-Fluoro-2’-deoxycytidine (2’-FdC) (Biosynth-Carbosynth) was dissolved in 100% DMSO (VWR Chemicals) ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Fabian Braun, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... After washing nanogold particles were enhanced for 2 minutes using HQ silver kit (Nanoprobes). Grids were contrasted as described above ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
John C. Ahn, Scott M. Coyle,
bioRxiv - Systems Biology 2023
Quote:
... 0.1 mg ml-1 PLL(20)-g[3.5]-PEG(2) (SuSoS CHF9,600.00) solution was added for 1 hour ...
-
No products found
because this supplier's products are not listed.
Alba Fernandez-Calvo, et al.,
bioRxiv - Biophysics 2024
Quote:
The (I91)2-ClfAN2N3-(I91)2 polyprotein was fluorescently labeled by utilizing the commercial protein Labeling Kit RED-NHS 2nd Generation (Nanotemper Technologies GmbH, Munich, Germany). The dye carries a reactive NHS-ester group that reacts with primary amines in the protein to form a covalent bond ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
Anti-TRPM7 2C7 mouse monoclonal antibody (anti-M7d, Figure 1-figure supplement 1) was produced by Eurogentec (Belgium) as follows ...
-
No products found
because this supplier's products are not listed.
Hye Mee Hwang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were incubated for 2hr with HRP-conjugated anti-mouse IgG diluted at 1:300 and followed by 1 hr incubation of TSA plus Cyanine-2 (1:300; cat#NEL745001KT, Akoya Biosciences). Sections were counterstained with DAPI and mounted on slides with CC/Mount mounting medium (cat# C9368 ...
-
No products found
because this supplier's products are not listed.
Hannah E. Wilson, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... plates at 10,000 cells.well-1 and differentiated in 2% horse serum (Atlanta Biologicals) in DMEM with antibiotics for 48 hours ...
-
No products found
because this supplier's products are not listed.
Ana L. Pereira, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Anthony D. Umpierre, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1-2 μL PCR product mixed with 0.9 μL PEI MAX (Polyscience, 24765-100) was directly transfected into HEK293T cells in the 96-well plate ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Jiah Kim, Nimish Khanna, Andrew S. Belmont,
bioRxiv - Cell Biology 2019
Quote:
Cells were plated on 35mm dishes with a #1 1/2 thickness glass coverslip bottom (MatTek, P35G-1.5-14-C) 48 hrs before imaging ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
David Bolumar, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or goat anti-rabbit (1:20,000; EXOAB-KIT-1; System Biosciences, Palo Alto, CA, USA). Protein signals were detected using the SuperSignal West Femto Chemiluminescent kit (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Grégorie Lebeau, et al.,
bioRxiv - Immunology 2023
Quote:
... 2 mM L-glutamine and 0.5 μg·mL−1 amphotericin B (PAN Biotech, Dutsher, Brumath, France) and containing 10 µg·mL−1 blasticidin and 100−1 µg·mL zeocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Oscar L. Rodriguez, et al.,
bioRxiv - Genomics 2022
Quote:
... 1-2 micrograms of high molecular weight DNA was sheared using g-tube (Covaris, Woburn, MA) to 5-9 Kbp at a 7000 RPM and size selected using the 0.75% DF 3-10kb Marker S1-Improved Recovery cassette definition on the Blue Pippin (Sage Science) ...
-
No products found
because this supplier's products are not listed.
Ming Zhou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
No products found
because this supplier's products are not listed.
Xinhao Song, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1 mL of bacterium suspension was transferred into 2 mL glass vials (AR0-37K0-13, Phenomenex) and sealed with designated caps (AR0-5760-13 ...
-
No products found
because this supplier's products are not listed.
Ruchi Malik, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Patch electrodes (2–4 MΩ) were pulled from borosilicate capillary glass of external diameter 1 mm (Sutter Instruments) using a Flaming/Brown micropipette puller (model P-2000 ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...