-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... C1q mouse ELISA (Hycult Biotech, HK211-01), Total C4 (LSBio ...
-
Cat# HY-W012480-500 mg,
500 mg, USD $50.0
Ask
Kangkang Niu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and RG108 (N-phthalyl-L-tryptophan, HY-13642, MedChemExpress, NJ, USA) were dissolved in DMSO (dimethyl sulfoxide) ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 and 3 (3M and 6M, mEPSCs), 2 and 6 (3M and 6M ...
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Marina Wright Muelas, et al.,
bioRxiv - Biochemistry 2020
Quote:
... L-Tryptophan-(indole-d5) (Cambridge Isotope Laboratories, DLM-1092), 5.625 μM ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
... N protein was detected using the SARS-CoV-2 NP ELISA kit from Bioss (cat# BSKV0001) according to the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H) is used followed by development in Betazoid DAB kit (Biocare Medical #BDB2004).
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
Alessandra Messikommer, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Activity of caspase-3 was detected with NucView 488 Caspase-3 Assay kit (Biotium) according to the instructions of the manufacturer.
-
No products found
because this supplier's products are not listed.
Ines Heyndrickx, et al.,
bioRxiv - Immunology 2023
Quote:
... treatments were given after mice were anesthetized with isoflurane (2 liters/min, 2 to 3%; Abbott Laboratories).
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Felix Wagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Chelsea D. Merkel, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Maximum projections of 2-3 um image stacks were created and deconvolved (3D Deconvolution) in NIS-Elements (Nikon) for presentation ...
-
No products found
because this supplier's products are not listed.
Paul McCusker, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 µL 1:1 diluted cDNA and SensiFAST SYBR No-ROX Kit (#BIO-98005, Bioline). Knockdown was assessed using ΔΔCt analysis as described by Pfaffl [92].
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
BL Spencer, et al.,
bioRxiv - Microbiology 2021
Quote:
EsxA sample purity was confirmed using tryptophan fluorescence (NanoTemper Tycho). Pure MBP was used as a negative control (sample impurity control ...
-
No products found
because this supplier's products are not listed.
Sinéad Kinsella, et al.,
bioRxiv - Immunology 2023
Quote:
... Gasdermin D was measured in freshly isolated thymocytes using Gasdermin D (mouse) ELISA Kit (Adipogen Life Sciences, AG-45B-0011-KI01). Lactate dehydrogenase was assessed from the supernatant of harvested thymocytes using Lactate Dehydrogenase assay (Abcam ...
-
No products found
because this supplier's products are not listed.
Caleb R. Carr, et al.,
bioRxiv - Microbiology 2024
Quote:
... 2 µL of 10 µM 3’ PacBio round 2 reverse primer (PacBio_3pri_RND2), and 25 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Christopher J. Black, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A roughly ∼2-4mm craniotomy and 2-3 pilot holes were drilled using a micro drill (Stoelting). Stainless steel screws (000-120 ...
-
No products found
because this supplier's products are not listed.
Yahaya A. Yabo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an Opal 3-Plex Manual Detection Kit (Akoya Biosciences) was used following the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Weiyi Xu, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 2- or 3-day-old Sprague-Dawley rat pups were purchased from Envigo and scarified for isolation of NRVMs upon arrival.
-
No products found
because this supplier's products are not listed.
Jan Niklas Hansen, et al.,
bioRxiv - Cell Biology 2021
Quote:
mIMCD-3 cells (mouse Inner Medullary Collecting Duct 3 cells) were obtained and authenticated from American Type Culture Collection (ATCC, CRL-2123). mIMCD-3 were maintained in DMEM/F12 (1:1 ...
-
No products found
because this supplier's products are not listed.
Reimi Tada, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... they were immersed in 0.05% ethyl-3-aminobenzoate (Tokyo Chemical Industry, 886-86-2). When adult male frogs were sacrificed to excise their testes for transgenesis ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... KLK10 in mouse plasma was measured by using a mouse KLK10 ELISA kit (Antibodies-online, ABIN628061).
-
No products found
because this supplier's products are not listed.
Maxime De Rudder, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Factor V serum protein concentration was assessed by ELISA following manufacturer’s instructions (Mouse factor V ELISA kit orb409284, Biorbyt).
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Changjun Yang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Adropin levels in mouse plasma were quantified using an ELISA kit (Cat. No. EK-032-35, Phoenix Pharmaceuticals, Inc., Burlingame, CA) as recommended by the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Alexandre G. Maganin, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The internal standard (IS) was: 6-Chloro-DL-tryptophan (TRP_Cl; Goldbio, St Louis, USA). All standards ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wei Liu, et al.,
bioRxiv - Bioengineering 2022
Quote:
Transfection of human pancreatic MIA PaCa-2 and BxPC-3 cells was performed with TransIT-mRNA (Mirus Bio) according to the manufacturer’s instructions ...