-
No products found
because this supplier's products are not listed.
Gustavo W. Fernandes, et al.,
bioRxiv - Physiology 2020
Quote:
... Plasma insulin level was obtained using Insulin (Mouse) ELISA Kit (Abnova). Acetyl Co-A levels in the liver and cells were obtained using the Acetyl-CoA Fluorometric Assay Kit (Biovision).
-
No products found
because this supplier's products are not listed.
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The ELISA for Bcl-2 was performed using a human Bcl-2 ELISA kit (LS-F4134, LSbio Lifespan Biosciences Inc, Seattle, WA, USA).
-
No products found
because this supplier's products are not listed.
Hyesoo Kim, Itay Budin,
bioRxiv - Biophysics 2023
Quote:
... tryptophan (Alfa Aesar) (20 mg/L) ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
Sachin N. Davis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... mouse anti-MEIS1/2/3 (0.5 µg/ml, 39795, Active Motif, RRID:AB_2750570), rabbit anti-DHRS3 (1:500 ...
-
No products found
because this supplier's products are not listed.
Jay Penney, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse-β-Tubulin 3 (TUJ1; GeneTex), rabbit-β-Tubulin 3 (BioLegend ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Miho Araki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... An Sftpc ELISA kit for the mouse was purchased from Aviva Systems Biology (OKEH01170) ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Jelena Osmanovic Barilar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... ELISA kit was purchased from Tecan IBL International (Hamburg ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
João Pedro Fonseca, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Measurements for cAMP ELISA and BCA Protein Assay kits were performed in a FlexStation 3 Multi-Mode Microplate Reader (Molecular Devices). The cAMP dose response to light was fit to a hyperbolic equation and confidence intervals were extracted by bootstrapping in a custom Python Script available on GitHub (https://qithub.com/jpfon/cAMP).
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The GST-ICD tryptophan mutations (“black” W22X) were purified through Glutathione Sepharose beads (GE Healthcare), followed by dialysis into pull-down buffer containing 100 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Surendra Raj Sharma, et al.,
bioRxiv - Immunology 2023
Quote:
... and ELISAs were detected with HRP-conjugated goat-anti-mouse IgG1-HRP (Southern Biotech). To develop the enzymatic reaction TMB was used as described above ...
-
No products found
because this supplier's products are not listed.
Jin-Woong Heo, et al.,
bioRxiv - Physiology 2023
Quote:
... for 2□min and 3% lead citrate (EMS, 22410) for 1□min ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Eloise J. Lockyer, et al.,
bioRxiv - Microbiology 2022
Quote:
... then treated wells were supplemented with 1mM L-tryptophan (VWR, J62508-09) dissolved in 0.1N NaOH at the same time as IFNγ stimulation ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Briefly, ACE-2 protein (Acro Biosystems, USA) was coated onto ELISA plates (Greiner, Germany) at 1 μg/mL concentration in PBS and was incubated (for 12-72 hours ...
-
No products found
because this supplier's products are not listed.
Gunsagar S. Gulati, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2-to-3-month-old C57BL/6J female mice (Jackson Laboratory) were used for fluorescent-minus-one (FMO ...
-
No products found
because this supplier's products are not listed.
Takuma Hayashi, Motoki Ichikawa, Ikuo Konishi,
bioRxiv - Immunology 2022
Quote:
... cTnT ELISA: Serum cTnT levels were determined with mouse cTnT ELISA Kit (CUSABIO TECHNOLOGY LLC, Houston, TX, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Danilo Correa Pinto Junior, et al.,
bioRxiv - Physiology 2023
Quote:
... Mouse circulating osteocalcin was measured by ELISA (Quidel kit Cat #60-1305). Blood testosterone levels were determined by RIA (Testo-US Cisbio Bioassays) ...
-
No products found
because this supplier's products are not listed.
S. L. Heaver, et al.,
bioRxiv - Microbiology 2021
Quote:
... lipids were extracted according to the PI(3)P Mass ELISA Kit (Echelon Biosciences Inc.) protocol ...
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Hannah J. Loghry, et al.,
bioRxiv - Immunology 2022
Quote:
... Tim-3 was neutralized using InVivoMAb anti-mouse Tim-3 antibodies (10µg/mL) (Bio X Cell, Lebanon, NH) for 1 h prior to rBma-LEC-1 or rBma-LEC-2 treatment.
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
Tryptophan and Kynurenine plasma concentrations were measured by using the Tryptophan ELISA (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Alberto Rissone, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... AG1478 (used 2-3 µM, Calbiochem, cat. # 658552) and 6-BIO (0.2 µM ...
-
No products found
because this supplier's products are not listed.
Kristin Metzdorf, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 μm thick FFPE sections were stained for SARS-CoV-2 with mouse-anti-nucleocapsid CoV-1/2 (Synaptic Systems, HS-452 11, clone 53E2, subtype: IgG2a) and for macrophages with rat-anti-mouse-MAC2 (Biozol Diagnostica/CEDARLANE,CL8942AP ...
-
No products found
because this supplier's products are not listed.
Chi Sun, et al.,
bioRxiv - Neuroscience 2021
Quote:
Each RNA sample was extracted from 2 retinae of a mouse using the NucleoSpin RNA Plus kit (Macherey-Nagel, PA). RNA concentrations were measured using a NanoDrop One spectrophotometer (ThermoFisher Scientific) ...
-
Mouse Tryptophan 2,3-Dioxygenase (TDO2) ELISA Kit is an ELISA Kit for the in vitro quantitative...
Cat# abx556115-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Omid Mashinchian, et al.,
bioRxiv - Bioengineering 2022
Quote:
2-3 devices from the same mouse were pooled and added to a Lysing Matrix D tube (MP Biomedicals, 116913500) on ice ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Fok-Moon Lum, et al.,
bioRxiv - Immunology 2019
Quote:
... The DNase-treated RNA (2 μg) was treated with Ribo-Zero using an Epicentre Ribo-Zero Gold Kit (Human/Rat/Mouse) (Epicentre) and re-purified on Ampure XP beads.
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Valeria Rudman-Melnick, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... and 65 mg of the minced tissue was placed in 2 ml digestion buffer containing 3 mg/mL Type 2 collagenase (Worthington, Collagenase Type 2), 1.5 mg/mL ProNase E (Sigma P6911) ...