-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Yingshan Li, et al.,
bioRxiv - Genetics 2022
Quote:
... RNAs associated with AGO1 were purified with TRI reagent (Molecular Research Center) and contaminant DNA was removed by DNase I treatment (Ibrahim et al. ...
-
No products found
because this supplier's products are not listed.
Miryam Adelfio, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Gingival cells were maintained in culture up to passage 6 in appropriate medium supplemented with associated growth factor kits (Lifeline Cell Technology, Frederick, MD). For passaging cells ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
FITC conjugated recombinant Mouse Kit (NP_001116205.1) extracellular domain (Met 1-Thr 523),...
Cat# Kit-4037MF,
50ug , USD $1298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Carl G. Litif, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Each chamber included two nose-poke (NP) holes associated with cocaine infusions (0.5 mg/kg/inf; NIDA) or delivery of sucrose pellets (15 mg; Bio-Serv). Each NP was paired with an availability light cue (always on until nose poked ...
-
No products found
because this supplier's products are not listed.
Candela Sánchez-Bellot, Andrew F. MacAskill,
bioRxiv - Neuroscience 2020
Quote:
... 70 μm thick slices were cut using a vibratome (Campden Instruments) in either the transverse ...
-
No products found
because this supplier's products are not listed.
Abhinav K. Maurya, et al.,
bioRxiv - Plant Biology 2019
Quote:
... and the monoterpene linalool (97%) (CAS: 78-70-6; Alfa Aesar). Finally ...
-
No products found
because this supplier's products are not listed.
Samuel Finkel, et al.,
bioRxiv - Bioengineering 2023
Quote:
... expanded in culture to 70% confluency in fibroblast growth medium (C-23130, Promocell), and cryopreserved for later use ...
-
No products found
because this supplier's products are not listed.
Bonita H. Powell, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Ex-protein fractions using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe set (ABI 4427975) ...
-
Cat# HY-P1505,
inquire
Ask
James A. Oo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Cells were treated at 70% confluence with 1 µM PROTAC AU-15330 (Medchemexpress, HY-145388) or DMSO in full growth medium (EGM ...
-
No products found
because this supplier's products are not listed.
AL Chenery, et al.,
bioRxiv - Immunology 2020
Quote:
... fusion proteins were generated of mouse IL-4 and IL-13 with the Fc portion of IgG1 (custom order with Absolute Antibody). Mice were injected intraperitoneally with either PBS ...
-
No products found
Jesse M. Hall, et al.,
bioRxiv - Immunology 2021
Quote:
... the lung homogenate was pushed through a 70 µm cell strainer (BioDesign Cell MicroSives Cat. N70R), creating a single-cell suspension ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Stephenie D. Prokopec, et al.,
bioRxiv - Genomics 2019
Quote:
... with the following changes: 1 μg of gDNA was sheared to 70-90bp fragments using the Covaris S220 (Covaris Inc., Woburn, MA) and 150bp fragment libraries were constructed according to standard SOLiD Fragment library protocols (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Yibo Tang, et al.,
bioRxiv - Immunology 2023
Quote:
The conjugations of peptides to the KLH protein carrier were performed according to the manufacturer instructions of ReadiLink™ KLH Conjugation Kit (AAT Bioquest, Cat.#5502). In brief ...
-
No products found
because this supplier's products are not listed.
Steven J. Burgess, et al.,
bioRxiv - Plant Biology 2019
Quote:
... selecting fragments from 70-350 bp for optimization (see He et al., 2014) and indexed for pooling using NextFlex DNA barcoded adapters (Bioo Scientific, Austin TX US). In order to reduce bias due to amplification of DNA fragments by the polymerase chain reaction ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Kevin W. Bollinger, et al.,
bioRxiv - Microbiology 2024
Quote:
... and Ldt3 was raised against purified protein (ProSci). To analyze protein levels by Western immunoblotting ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Stijn De Munter, et al.,
bioRxiv - Immunology 2023
Quote:
... 10 μM Rho-associated coiled–coil containing protein kinase (ROCK) inhibitor Y-27632 (Abmole) and 5 μM A83-01 (Tocris Bioscience)) ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
S. Jake Gonzales, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.7 µl template switch oligo (TSO) (10 µM, f/c 200 nM, IDT DNA; #110, Supplementary table 5), nuclease-free water till 35 µl and subsequent incubation at 42°C for 2 hours ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michelle Wintzinger, et al.,
bioRxiv - Physiology 2022
Quote:
... we followed general guidelines associated with the staining assay #KTMTR2LT (StatLab; McKinney, TX). Briefly ...
-
No products found
because this supplier's products are not listed.
Stefano Conti Nibali, et al.,
bioRxiv - Biophysics 2023
Quote:
... 70 compounds were purchased from Enamine and tested experimentally.
-
No products found
because this supplier's products are not listed.
Robert Horvath, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
We identified TE polymorphisms significantly associated with environmental factors using genome-environment association analyses (GEA) following Minadakis et al ...
-
No products found
because this supplier's products are not listed.
Kelly L. Weaver, et al.,
bioRxiv - Immunology 2021
Quote:
... Homogenized samples were strained for separation using 70 μM pore nylon mesh (Elko Filtering Co, Cat. #03-70/33) and centrifuged for 5 minutes at 1,000 x g ...
-
No products found
because this supplier's products are not listed.
Joseph W. Golden, et al.,
bioRxiv - Microbiology 2020
Quote:
... equal amounts of 70% Ethanol (Decon Laboratories, Inc) was added to the aqueous layer ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Claudia Feriotti, et al.,
bioRxiv - Microbiology 2021
Quote:
... anti-SARM1 (anti-chicken, 1:70; generated by Icosagen by immunizing chicken with the TIR domain of human SARM1) ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Monika Moissidis, et al.,
bioRxiv - Neuroscience 2024
Quote:
... to stain cells infected with adeno-associated viruses expressing mCherry or against GFP (using a combination of two rabbit anti-GFP antibodies, 1:500, Aves Labs #GFP-1020 and Abcam #ab13970) to reveal the endogenous GFP signal of MGE-derived cells labeled with an RCE reporter ...
-
No products found
because this supplier's products are not listed.
Willemijn S de Voogt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Grids were loaded in a liquid nitrogen-precooled 70° tilt cryo-transfer system (Gatan, Inc.) and inserted in a Tecnai G2 20 TWIN 200kV transmission electron microscope (FEI) ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Erik G. Schad, Christian P. Petersen,
bioRxiv - Developmental Biology 2022
Quote:
... mixed with 600ul 70% ethanol and purified using 96-well column silica-membrane filter plates (Epoch Life sciences 2020-001) positioned over 2ml deep-well 96-well plates (VWR 40002-014 ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and anti-mouse (for HA; Covalab) were used as secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).