-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Danya Abazari, et al.,
bioRxiv - Neuroscience 2022
Quote:
Protein palmitoylation assay was performed using CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), as described by manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Benedikt Graf von Armansperg, et al.,
bioRxiv - Microbiology 2020
Quote:
Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Ramhari Kumbhar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-PAR (4335-MC-100; Trevigen), rabbit anti-pan PAR (MABE1016 ...
-
No products found
because this supplier's products are not listed.
Kun Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... To reconstitute MBOAT7 proteins in PMAL-C8 (Anatrace), MBOAT7 in detergent was mixed with PMAL-C8 at a 1:3 (w:w ...
-
No products found
because this supplier's products are not listed.
Lijun Cao, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The purified protein was digested with PreScission Protease (APEXBIO) to remove GST tag and treated with 25 mM DTT or 50 μM H2O2 at 25 °C for 30 min ...
-
No products found
because this supplier's products are not listed.
Changrui Lu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... An aliquot of 4 μL protein sample of Spike protein was applied onto a glow-discharged 300 mesh grid (Quantifoil Au R1.2/1.3) and GraFuture™-RGO grid which was supported with a thin layer of RGO (reduced graphene oxide) ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Hemangi Patil, Kyoung-in Cho, Paulo A. Ferreira,
bioRxiv - Genetics 2024
Quote:
The UbiQuant ELISA kit as directed by the manufacturer (LifeSensors, Malvern, PA) was used to determine the absolute and total amount of ubiquitin and ubiquitylated proteins in the RPE ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Andrea D. Thompson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Adenovirus drove expression of scrambled short hairpin RNA (ShRNA)(Vector Biolabs, shADV #207157) or BAG3 ShRNA (Vector Biolabs ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Juan F. Codocedo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One portion of the homogenate was further sonicated for protein extraction and western blot and ELISA analysis and the other was stored at -80 °C in RNA bee (Amsbio, CS-501B) for RNA extraction and gene expression analysis.
-
No products found
because this supplier's products are not listed.
Emma V Parkins, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-PSD-95 MAGUK scaffold protein mouse monoclonal (Antibodies Incorporated Cat# 75-348, RRID:AB_2315909), Synapsin-1 rabbit polyclonal Sigma-Aldrich Cat# S193 ...
-
No products found
because this supplier's products are not listed.
Flore Oudouhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... The production of proteins was assessed with monoclonal mouse anti-Helicobacter pylori CagA (HyTest Ltd.) and rabbit Cagα antiserum (Abcam) ...
-
No products found
because this supplier's products are not listed.
Sachin S. Katti, et al.,
bioRxiv - Biophysics 2021
Quote:
Chloroform solutions of long-chain 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) and short-chain 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC) (Avanti Polar Lipids), or their deuterated versions d54-DMPC (Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Jixiang Kong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... DsRed fluorescence signal in canola and soybean primary node transformation experiments was monitored by using a Zeiss SV11 stereomicroscope coupled with the mercury vapor short-arc illuminator HBO 100W (Carl Zeiss Vision International GmbH ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
AL Chenery, et al.,
bioRxiv - Immunology 2020
Quote:
... fusion proteins were generated of mouse IL-4 and IL-13 with the Fc portion of IgG1 (custom order with Absolute Antibody). Mice were injected intraperitoneally with either PBS ...
-
No products found
because this supplier's products are not listed.
Peixiang Zhang, et al.,
bioRxiv - Physiology 2022
Quote:
... mice were maintained on mouse chow (diet D1001 containing 10 kcal% fat, 20 kcal% protein and 70 kcal% carbohydrate; Research Diets, New Brunswick, NJ) or chow containing simvastatin (0.1 g/Kg body weight in mouse chow ...
-
Cat# HY-K0701-5 Assays,
5 Assays, USD $480.0
Ask
Muhammad Jamal, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The protein signal in the membrane was detected by using an ultra-high sensitivity ECL kit (MedChemExpress, USA). Antibodies ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Aditi Verma, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse brain was placed on mouse brain matrix (Ted Pella, Inc Cat# 15050) and 1mm thick slices of the brain were obtained for the dissection of SNpc ...
-
No products found
because this supplier's products are not listed.
Alexander W. Justin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Green fluorescent protein (GFP) and Red Fluorescent Protein (RFP) human umbilical vein endothelial cells (HUVECs, Promocell), normal human lung fibroblasts (NHLFs ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Dongying Chen, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... To harvest protein lysate from IBIDI µSlide ...
-
No products found
because this supplier's products are not listed.
Yibo Tang, et al.,
bioRxiv - Immunology 2023
Quote:
The conjugations of peptides to the KLH protein carrier were performed according to the manufacturer instructions of ReadiLink™ KLH Conjugation Kit (AAT Bioquest, Cat.#5502). In brief ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...