-
No products found
because this supplier's products are not listed.
Wei Wei, et al.,
bioRxiv - Biochemistry 2024
Quote:
... N-acetyl-L-threonine (CHEM-IMPEX INT’L INC, 03262), N-acetyl-L-alanine (Sigma ...
-
No products found
because this supplier's products are not listed.
Wenlin Liao, Kun-Ze Lee, San-Hua Su, Yuju Luo,
bioRxiv - Neuroscience 2020
Quote:
... phosphorylated KCC2 at threonine 1007 (pKCC2-T1007; 1:5,000, PhosphoSolutions), Na+/K+/Cl- co-transporter 1 (NKCC1 ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Maria Carmen Ocaña, et al.,
bioRxiv - Biochemistry 2021
Quote:
... serine and glycine free media were from Teknova (Hollister, CA, USA) and from US Biological Life Sciences (Salem ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Daniel Perez-Zsolt, et al.,
bioRxiv - Microbiology 2021
Quote:
... centrifuged to remove cellular debris and assayed with a SARS-CoV-2 Nucleocapsid protein (NP) High-sensitivity Quantitative ELISA (ImmunoDiagnostics). For degradation experiments ...
-
No products found
because this supplier's products are not listed.
Samantha L Scudder, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Custom rabbit (pAb; Clone #07) anti-Rpt6 phospho-specific antibody for serine 120 (pS120) was previously generated commercially (ProSci) against a synthetic phosphorylated peptide (Djakovic et al. ...
-
No products found
because this supplier's products are not listed.
Juan F. Codocedo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One portion of the homogenate was further sonicated for protein extraction and western blot and ELISA analysis and the other was stored at -80 °C in RNA bee (Amsbio, CS-501B) for RNA extraction and gene expression analysis.
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Benedikt Graf von Armansperg, et al.,
bioRxiv - Microbiology 2020
Quote:
Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
No products found
because this supplier's products are not listed.
Margarida Beatriz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Mitochondrial movement videos were acquired on a Zeiss Cell Observer Spinning Disk System (Carl Zeiss Microscopy). For reference purposes ...
-
No products found
because this supplier's products are not listed.
Emma V Parkins, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-PSD-95 MAGUK scaffold protein mouse monoclonal (Antibodies Incorporated Cat# 75-348, RRID:AB_2315909), Synapsin-1 rabbit polyclonal Sigma-Aldrich Cat# S193 ...
-
No products found
because this supplier's products are not listed.
Flore Oudouhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... The production of proteins was assessed with monoclonal mouse anti-Helicobacter pylori CagA (HyTest Ltd.) and rabbit Cagα antiserum (Abcam) ...
-
No products found
because this supplier's products are not listed.
Glenda Guek Khim Oh, et al.,
bioRxiv - Plant Biology 2021
Quote:
Mitochondrial respiration rate measurements were performed using the Clark-type oxygen electrode (Hansatech) with 120 - 240 μg of enriched mitochondria in 1 mL of mitochondrial respiration buffer (0.3M Sucrose ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Christoph G. Gäbelein, et al.,
bioRxiv - Cell Biology 2021
Quote:
... (B) Coupling mitochondrial extraction with transplantation from individual cell to cell: One quadrant of a 4-well micro-insert (ibidi) was seeded with recipient HeLa (su9-BFP ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
Daniel Pokorny, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Both wild-type and kinase-dead (D286A) Sgk3 were expressed in baculvirus-infected Sf9 insect cells grown in ESF 921 medium (Expression Systems) at 27°C ...
-
No products found
because this supplier's products are not listed.
Peixiang Zhang, et al.,
bioRxiv - Physiology 2022
Quote:
... mice were maintained on mouse chow (diet D1001 containing 10 kcal% fat, 20 kcal% protein and 70 kcal% carbohydrate; Research Diets, New Brunswick, NJ) or chow containing simvastatin (0.1 g/Kg body weight in mouse chow ...
-
No products found
because this supplier's products are not listed.
Alexandra A. Abu-Shmais, et al.,
bioRxiv - Immunology 2023
Quote:
... a unique DNA barcode was directly conjugated to the antigen using a SoluLINK Protein-Oligonucleotide Conjugation kit (TriLink, S-9011) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Aditi Verma, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse brain was placed on mouse brain matrix (Ted Pella, Inc Cat# 15050) and 1mm thick slices of the brain were obtained for the dissection of SNpc ...
-
No products found
because this supplier's products are not listed.
Alexander W. Justin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Green fluorescent protein (GFP) and Red Fluorescent Protein (RFP) human umbilical vein endothelial cells (HUVECs, Promocell), normal human lung fibroblasts (NHLFs ...
-
No products found
because this supplier's products are not listed.
Yibo Tang, et al.,
bioRxiv - Immunology 2023
Quote:
The conjugations of peptides to the KLH protein carrier were performed according to the manufacturer instructions of ReadiLink™ KLH Conjugation Kit (AAT Bioquest, Cat.#5502). In brief ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Kun Wang, et al.,
bioRxiv - Biochemistry 2022
Quote:
... To reconstitute MBOAT7 proteins in PMAL-C8 (Anatrace), MBOAT7 in detergent was mixed with PMAL-C8 at a 1:3 (w:w ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
Bart Smeets, et al.,
bioRxiv - Biophysics 2019
Quote:
... 10 or 20 µM Rho-kinase inhibitor Y-276323 (Axon Medchem).
-
No products found
because this supplier's products are not listed.
AL Chenery, et al.,
bioRxiv - Immunology 2020
Quote:
... fusion proteins were generated of mouse IL-4 and IL-13 with the Fc portion of IgG1 (custom order with Absolute Antibody). Mice were injected intraperitoneally with either PBS ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...