-
No products found
because this supplier's products are not listed.
Xinxin Kou, Xiaoxia Yang, Zheng Zhao, Lei Li,
bioRxiv - Cancer Biology 2023
Quote:
... anti-PTEN-induced kinase 1 (PINK1) (ab300623, Abcam), anti-parkin (ab77924 ...
-
No products found
because this supplier's products are not listed.
Ryan Houston, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PINK1 (Cell Signaling, 6946S), OMA1 (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Priyanka Gajwani, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and Pink1 (Millipore Sigma, TRCN0000199446 ...
-
No products found
because this supplier's products are not listed.
Ling Sun, et al.,
bioRxiv - Neuroscience 2019
Quote:
Mitochondrial membrane potential was assessed in WT and pink1-KO HeLa cells with the probe JC-1 (Invitrogen). JC-1 accumulates within the intact mitochondria to form multimer J-aggregates that result in a shift of fluorescence from green (530 nm ...
-
No products found
because this supplier's products are not listed.
Alice Lepelley, et al.,
bioRxiv - Neuroscience 2020
Quote:
... PINK1 (1:1,000, Novus Biologicals), LC3b (1:2,000 ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti PINK1 (#sc-517353, Santa Cruz), sheep anti p-PINK1 Thr-257 (#68-0057-100 ...
-
No products found
because this supplier's products are not listed.
Briana N Markham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PINK1 (Qiagen, SI00287931), and AllStars Negative control (Qiagen ...
-
No products found
because this supplier's products are not listed.
Margarida Beatriz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... anti-PINK1 (1:100, #846201, BioLegend), anti-LC3A/B (1:400 ...
-
No products found
because this supplier's products are not listed.
Carl-Christian Kolbe, Eicke Latz,
bioRxiv - Biochemistry 2020
Quote:
... His-MBP-PINK1 (R&D Systems, Cat. # AP-180-100) concentration was set to 50 ng/µl ...
-
No products found
because this supplier's products are not listed.
Christopher S. Waters, et al.,
bioRxiv - Systems Biology 2022
Quote:
... the PINK1 insert was derived from pCMVTNT-PINK1-C-Myc (Addgene, #13314) and the mNeonGreen insert was obtained as cDNA (Allele Biotech ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... The PINK1 knockout mice (PINK1−/−) were procured from Jackson Laboratory.
-
No products found
because this supplier's products are not listed.
Shanshan Ding, et al.,
bioRxiv - Biochemistry 2020
Quote:
The activity of phosphatase was determined by the Serine/Threonine Phosphatase Assay System kit from Promega Company ...
-
No products found
because this supplier's products are not listed.
Fangfang Song, et al.,
bioRxiv - Physiology 2023
Quote:
... and mouse Igf1 ELISA kit (Mouse IGF-1 ELISA Kit, Cat#80574, Crystal Chem). HOMA-IR was calculated as follows ...
-
No products found
because this supplier's products are not listed.
Yujun Hou, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Pink1 (catalog no. 23274-1-AP; Proteintech); Parkin (catalog no ...
-
No products found
because this supplier's products are not listed.
Jia Chen, et al.,
bioRxiv - Plant Biology 2024
Quote:
... for protein immunoblotting using anti-phospho-Serine/Threonine (ABclonal, AP0893) antibody.
-
No products found
because this supplier's products are not listed.
Priyanka Gajwani, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Pink1 sgRNAs were designed and cloned to pGS plasmid (Genscript, #1 GCTGGTCCCGGCAAGCCGCG ...
-
No products found
because this supplier's products are not listed.
Y. Bill Kim, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Leena Sapra, et al.,
bioRxiv - Immunology 2021
Quote:
... Protein transport inhibitor cocktail and Mouse TNF-α (560478) ELISA kit were procured from BD (USA). The following ELISA kits were brought from R&D ...
-
No products found
because this supplier's products are not listed.
Elena Giusto, et al.,
bioRxiv - Neuroscience 2023
Quote:
The commercially available ELISA kits for human p21 protein (Cdc42/Rac)-activated kinase 6 (PAK6) (Mybiosource, MBS9318071) and for Human YWHAG (14-3-3γ ...
-
No products found
because this supplier's products are not listed.
Shrivani Sriskanthadevan-Pirahas, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Mitochondrial protein concentration was determined using the Dc-protein determination kit (BioRad).
-
No products found
because this supplier's products are not listed.
Moh’d Mohanad Al-Dabet, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Urine albumin was determined using a mouse albumin ELISA kit (Mouse albumin ELISA quantification kit, Bethyl Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sieglinde Hastreiter, et al.,
bioRxiv - Physiology 2024
Quote:
ELISA: Insulin ELISA (Mouse Insulin ELISA, Mercodia) and Leptin ELISA (Quantikine Mouse/Rat Leptin Immunoassay ...
-
No products found
because this supplier's products are not listed.
Tana S. Pottorf, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ryan Houston, et al.,
bioRxiv - Cell Biology 2021
Quote:
... of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system, Clontech) into the SalI-XhoI of the pLenti-CMV-Neo vector ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Karolina Wołodko, et al.,
bioRxiv - Physiology 2020
Quote:
... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
No products found
because this supplier's products are not listed.
Patricia J. Ahl, et al.,
bioRxiv - Immunology 2020
Quote:
... Mitochondrial respiration parameters were measured using the mitochondrial stress test kit (Seahorse Bioscience, 103015-100), by sequentially adding oligomycin (2 μM) ...
-
No products found
because this supplier's products are not listed.
Hu Wang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and PINK1 p.I368N-2# (1067#) were cultured using mTeSR (STEMCELL Technologies, Catlog #85850) media on Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse HMGB1(high mobility group protein B1) ELISA Kit from Elabscience (Houston, TX). The optical density readings obtained were used to generate a four-parameter logistic curve and the concentration of the analytes in the samples were calculated by comparing to the standard curve generated.
-
No products found
because this supplier's products are not listed.
Ning Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mitochondrial proteins were extracted by Mitochondrial Extraction Kit (SM0020, Solarbio), according to the instructions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Nikhil J. Parekh, et al.,
bioRxiv - Immunology 2019
Quote:
IFN-β protein was detected using the mouse Hi-Sensitivity IFN-β ELISA kit (PBL Assay Science). CCL4 protein was detected using the mouse CCL4/MIP-1 beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Tshegofatso Ngwaga, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
David E. Ochayon, et al.,
bioRxiv - Immunology 2019
Quote:
... The inhibition of MK2 (p38/mitogen-activated protein kinase-activated protein kinase 2) was performed with 5 μM MK2 IV (CAYMAN chemical, Ann Arbor, MI). The inhibition of ADAM-17 (a disintegrin and metalloprotease-17 ...
-
No products found
because this supplier's products are not listed.
Wenjing Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... Quantitation of urinary albumin and creatinine was carried out using mouse albumin-specific ELISA kits (Roche) and creatinine determination kits (Enzymatic Method ...
-
No products found
because this supplier's products are not listed.
Bert van de Kooij, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The serine/threonine peptide library (Kinase Substrates Library, Group I and Group II, Anaspec) consists of 198 peptide pools with the sequence Y-A-Z-X-X-X-X-S/T-X-X-X-X-A-G-K-K-(LC-Biotin)-NH2 ...
-
No products found
because this supplier's products are not listed.
Sanjib Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mitochondrial ferritin in HCEC-B4G12 and F35T cells were quantified using Immunotag™ Mitochondrial Ferritin ELISA kit (G-Biosciences, USA). Protein was extracted following the same protocol mentioned above in cytosolic ferritin ELISA ...
-
No products found
because this supplier's products are not listed.
Syed-Rehan A. Hussain, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Mitochondrial DNA was isolated using Mitochondrial/Cytosolic Fractionation Kit (BioVision Inc., CA; cat# K256-25) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lynette A. Desouza, et al.,
bioRxiv - Neuroscience 2021
Quote:
... namely the mitogen activated protein kinase kinase (MAPKK) inhibitor U0126 (50 μM) and the CaM kinase II (CaMKII) inhibitor KN-62 (10 μM) (Tocris Bioscience, United Kingdom). The inhibitors were added to the cultures thirty minutes prior to DOI treatment ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rho-associated protein kinase inhibitor (3 uM; 1293823; PeproTech) was added to the media for 1 day post replating.
-
No products found
because this supplier's products are not listed.
Kevin R. Bewley, et al.,
bioRxiv - Pathology 2020
Quote:
... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ...
-
No products found
because this supplier's products are not listed.
Xilin Wu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the protein was coated to high protein-binding ELISA plates (Corning) at a concentration of 0.5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A corticosterone ELISA kit (Enzo Life Sciences) was used to quantify corticosterone levels in blood serum samples ...
-
No products found
because this supplier's products are not listed.
Dina Aweida, Shenhav Cohen,
bioRxiv - Cell Biology 2022
Quote:
... anti-phospho-Threonine/Serine from ECM Biosciences, and anti-PLAA from Invitrogen ...
-
No products found
because this supplier's products are not listed.
Isabel Soto, et al.,
bioRxiv - Neuroscience 2024
Quote:
PINK1-/- (n=20) and wild-type (WT) Long Evans (n=14) rats were acquired from Envigo/Inotiv (Boyertown ...
-
No products found
because this supplier's products are not listed.
Bianca M. Esch, et al.,
bioRxiv - Genetics 2020
Quote:
For serine incorporation assays using [13C315N1]-serine (Cambridge Isotope Labs) samples were eluted from a PepMap C18 easy spray column (Thermo ...
-
No products found
because this supplier's products are not listed.
Ryosuke Hiwa, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse anti-dsDNA IgG-specific ELISA Kit was from Alpha diagnostic. Mouse IL-2 DuoSet ELISA DuoSet and Ancillary Reagent Kit 2 were from R&D Systems.
-
No products found
because this supplier's products are not listed.
Marek Petráš, et al.,
bioRxiv - Microbiology 2020
Quote:
The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
No products found
because this supplier's products are not listed.
Rachel M. Stewart, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the Mouse-on-Mouse (MOM) Immunodetection kit Blocking Reagent and Protein Diluent (Vector Laboratories) were used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Taisei Kikuchi, et al.,
bioRxiv - Genomics 2020
Quote:
Mitochondrial genomes (mitogenomes) were reconstructed from Illumina reads with MITObim version 1.6 [54] ...