-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Joke Mertens, et al.,
bioRxiv - Genetics 2021
Quote:
Day-3 embryos were warmed using the Vitrification Thaw kit (Vit Kit-Thaw, Irvine Scientific, USA) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miho Araki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... An Sftpc ELISA kit for the mouse was purchased from Aviva Systems Biology (OKEH01170) ...
-
No products found
because this supplier's products are not listed.
Alan Bush, et al.,
bioRxiv - Neuroscience 2021
Quote:
... strips with 54 or 63 contacts each (platinum 1 mm disc contacts arranged in a 3×18 or 3×21 layout, with 3 mm center to center spacing, PMT Cortac Strips models 2110-54-001 and 2011-63-002 ...
-
No products found
because this supplier's products are not listed.
Tatsuaki Kurata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next day the plasmid was extracted from 3 mL of the culture using Favorprep Plasmid Extraction Mini Kit (Favorgen Biotech Corp.). 500 ng of the plasmid mix was again transformed into BW25113 carrying a toxin expression plasmid and let to recover as before ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
No products found
because this supplier's products are not listed.
Hugo Gizardin-Fredon, et al.,
bioRxiv - Biophysics 2023
Quote:
... Six-well reusable silicone gaskets (CultureWellTM, 50-3 mm DIA × 1mm Depth, 3-10 μL, Grace Bio-Labs, Inc., Oregon, USA) were carefully cut and assembled on the cover slide center ...
-
No products found
because this supplier's products are not listed.
Marvin J. Sandoval, et al.,
bioRxiv - Immunology 2021
Quote:
... and then incubated with mouse IFNλ2/3 DNA probes (Advanced Cell Technologies), followed by a series of RNA Scope adaptor probes ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Elke M. Muntjewerff, et al.,
bioRxiv - Physiology 2021
Quote:
... Mouse EIA kits from CUSABIO (CUSABIO Technology LLC, Houston, TX) were used to determine CgA (CSB-EL005344MO) ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Anne-Charlotte Bon-Mathier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Neonatal C57BL/6 mice (3 days after birth) were injected ip with NaCl or BNP every two days (1µg/2g; Bachem; synthetic mouse BNP (1-45) peptide (catalog number H-7558)) ...
-
No products found
because this supplier's products are not listed.
Na Fei, et al.,
bioRxiv - Physiology 2023
Quote:
... Serum LBP level was measured by a Mouse Lipopolysaccharide Binding Protein ELISA Kit (HyCult Biotechnology, Uden, The Netherlands). All assays were performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Chao Gao, et al.,
bioRxiv - Biochemistry 2020
Quote:
... for 3 min and separated on a C18 analytical column (picofrit 75 μm ID x 150 mm, 3 μm, New Objective) using a linear gradient of 2 % to 45 % solvent B (80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Michael H. Myoga, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 mm tip-diameter reusable feeding needle (Fine Science Tools), operated using a normally closed pinch valve (NResearch ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Dmitry Shvarev, et al.,
bioRxiv - Biochemistry 2023
Quote:
... ATTO488-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (ATTO488) was obtained from ATTO-TEC GmbH (Siegen ...
-
No products found
because this supplier's products are not listed.
Pablo Hurtado, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... measuring the fluorescent signal after a 3 hour incubation using FLUOstar OPTIMA (BMG Labtech) plate reader.
-
No products found
because this supplier's products are not listed.
Joaquín J Rodriguez Galvan, et al.,
bioRxiv - Microbiology 2024
Quote:
... TMPRSS2 kit from BPS Bioscience (#78083) was used and instructions were followed from the kit for kinetic measurements ...
-
No products found
because this supplier's products are not listed.
Sophie Vieweg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used a caspaTag fluorescein caspase 3 activity kit (ImmunoChemistry Technologies, MN, USA), which allows the detection of active effector caspase (caspase 3 ...
-
No products found
because this supplier's products are not listed.
Hanyue Cecilia Lei, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mice fed ad libitum were given 3 g/mouse of the reward sugar pellet (Dustless Precision Pellet, F0071, Bio-Serv) on the bedding of their home cages when cages were changed at ZT12 ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
Anil G Cashikar, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse primary astrocytes were seeded at a density of 3 X 104 cells in a 8-well chamber slide (CellVis, C8-1.5P). Oleic acid was added as Oleic acid-bovine serum albumin (Sigma O-3008 ...
-
No products found
because this supplier's products are not listed.
Domenico Viola, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with 100 μl of the D-Luciferin solution at a final dose of 3 mg/20 g mouse body weight (Biosynth, Cat. No. L-82220) and then gas-anaesthetized with isoflurane (Faulding Pharmaceuticals) ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... Custom mouse diets were formulated at Research Diets (New Brunswick, NJ ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...