-
No products found
because this supplier's products are not listed.
Yunlong Zhao, et al.,
bioRxiv - Immunology 2019
Quote:
... 3 nM mouse PD-L1-His/9 nM mouse CD80-His (Sino Biological, catalog 50446-M08H) combined ...
-
No products found
because this supplier's products are not listed.
Ryosuke Ono, et al.,
bioRxiv - Cancer Biology 2023
Quote:
H1299 cells (3×106 cells/mouse) mixed with matrigel (Corning, Corning, NY) and B16 cells (2×105 cells/mouse ...
-
No products found
because this supplier's products are not listed.
Sachin N. Davis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... mouse anti-MEIS1/2/3 (0.5 µg/ml, 39795, Active Motif, RRID:AB_2750570), rabbit anti-DHRS3 (1:500 ...
-
No products found
because this supplier's products are not listed.
Lucie Darmusey, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
No products found
because this supplier's products are not listed.
Jack F. Webster, et al.,
bioRxiv - Neuroscience 2019
Quote:
... unfixed C57BL/6 mouse brains (N = 3) were embedded in tissue freezing medium (Leica Biosystems, Richmond, UK), frozen on a dry ice ethanol bath ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and RLN3(orb315124) ELISA Kits were purchased from Biorbyt LLC ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
RNA was extracted from mouse brain lysates (mixture of 3∼4 mouse brains for each sample) using RNAprep pure Tissue Kit (Tiangen, DP431). cDNA was synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme ...
-
No products found
because this supplier's products are not listed.
Victoria A. Hassebroek, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse anti-SUMO2/3 (#12F3, Cytoskeleton Inc), Guinea Pig anti-SUMO2/3 (1:300 ...
-
No products found
because this supplier's products are not listed.
Hannah J. Loghry, et al.,
bioRxiv - Immunology 2022
Quote:
... Tim-3 was neutralized using InVivoMAb anti-mouse Tim-3 antibodies (10µg/mL) (Bio X Cell, Lebanon, NH) for 1 h prior to rBma-LEC-1 or rBma-LEC-2 treatment.
-
No products found
because this supplier's products are not listed.
Anthony J. Covarrubias, et al.,
bioRxiv - Immunology 2019
Quote:
... a Mouse TLR Agonist kit was purchased from Invivogen and BMDMs were treated with each ligand for 16 hours ...
-
No products found
because this supplier's products are not listed.
Alessandra Messikommer, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Activity of caspase-3 was detected with NucView 488 Caspase-3 Assay kit (Biotium) according to the instructions of the manufacturer.
-
No products found
because this supplier's products are not listed.
Yahaya A. Yabo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an Opal 3-Plex Manual Detection Kit (Akoya Biosciences) was used following the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Juntao Yu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Mouse PBMCs were purified from mouse whole blood by Mouse PBMC Isolation Kit (Solarbio, Beijing, China). All the mentioned cell lines were maintained under sterile conditions and cultured at 37°C in a 5% CO2 environment.
-
No products found
because this supplier's products are not listed.
Cécile Morin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA using a mouse peptidoglycan (PG) ELISA Kit (MBS263268, MyBioSource) [49] was performed following the manufacturer’s instructions.
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Fan Zhang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the mouse knee was minced into small fragments and digested with 3 mg/ml collagenase type I (Worthington) and 4 mg/ml dispase (Roche ...
-
No products found
because this supplier's products are not listed.
E. C. Brombacher, et al.,
bioRxiv - Immunology 2023
Quote:
... 3% SDS (151-21-3, VWR Life Science) and 100 mM Tris–HCl [pH 6.8](1.00317 ...
-
No products found
because this supplier's products are not listed.
S. Karkampouna, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Magnetic cell sorting was performed to separate purified human versus mouse cell fractions using the Mouse Cell Depletion Kit (Miltenyi Biotek, 130-104-694). For the proteomic experiments ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Ichiro Yamauchi, et al.,
bioRxiv - Physiology 2023
Quote:
... TSH AccuLite VAST CLIA kit (Monobind Inc., Lake Forest, CA). We diluted serum samples 25-fold with phosphate buffered saline when we measured human TSH levels ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Stefanos Giannakopoulos, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse LH ELISA Kit (Abclonal Cat. # RK02986). All assays using normalized protein amounts were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Omid Mashinchian, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Abel Ferrel, et al.,
bioRxiv - Microbiology 2022
Quote:
... and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was detected using mouse monoclonal anti-GAPDH antibody 6C5 (Calbiochem). Horseradish peroxidase (HRP ...
-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human or mouse FFPE tumor tissue sections were deparaffinized in xylene alternative (Histo-Clear, EMS; 3×5 min) and rehydrated in EtOH/H2O gradient series (100% ...
-
No products found
because this supplier's products are not listed.
Omid Mashinchian, et al.,
bioRxiv - Bioengineering 2022
Quote:
2-3 devices from the same mouse were pooled and added to a Lysing Matrix D tube (MP Biomedicals, 116913500) on ice ...
-
No products found
because this supplier's products are not listed.
Claudia Bartoli, et al.,
bioRxiv - Pathology 2022
Quote:
... library was prepared using the EXP-NBD103 and SQK-LSK108 kits according to the manufacturer’s instructions and starting with 3 μg of 20 kb sheared DNA (Megaruptor, Diagenode) as input ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H) is used followed by development in Betazoid DAB kit (Biocare Medical #BDB2004).
-
No products found
because this supplier's products are not listed.
Daniel Neumeier, et al.,
bioRxiv - Immunology 2021
Quote:
... (3) Quenching of biosensors in 50 μg/ml polyclonal mouse IgG (Rockland, 010-0102) for 300 s ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicole M. Davis, et al.,
bioRxiv - Pathology 2021
Quote:
... body temperatures were measured using a thermocouple thermometer and mouse rectal probe (World Precision Instruments, RET-3). Blood glucose measurements were obtained with 2uL of tail vein blood analyzed with a Bayer CONTOUR Blood Glucose Monitor and Test Strips ...
-
No products found
because this supplier's products are not listed.
Andrea Toledo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... were incubated overnight with 2 µg of antibody raised against an intracellular epitope in mouse NLGN1 (aminoacids 826 to 843) and which recognizes all NLGNs 1/2/3/4 (Synaptic Systems, #129 213). Antibody-bound NLGNs were incubated for 1 hour with 20 µL of protein G beads (Dyna-beads Protein G ...
-
No products found
because this supplier's products are not listed.
Joanne Durgan, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3-micron beads (Polysciences Inc) were resuspended in 0.1 M Borate and incubated with human IgG at 4°C overnight while rotating ...
-
No products found
because this supplier's products are not listed.
Joshua D. Frenster, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were then lysed and cAMP levels were measured using the cAMP Gs dynamic kit on the FlexStation 3 (Molecular Devices), according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Ramile Dilshat, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... mouse anti-PI(3)P (1:100; Echelon Biosciences Inc.), mouse anti-PI(3,4)P2 (1:100 ...
-
No products found
because this supplier's products are not listed.
Jacob W. Myerson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... with separate compartments for each mouse (MPC-3 AERO; Braintree Scientific). To maintain adequate hydration ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
Peter Radvak, et al.,
bioRxiv - Immunology 2021
Quote:
... in mouse lung and liver homogenates were quantitated using VeriKine mouse IFN-α or Verikine High Sensitivity mouse IFN-β ELISA kits (PBL Assay Science, Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Youn Hee Cho, et al.,
bioRxiv - Microbiology 2020
Quote:
Blocked blots were washed three times in 1 × TBST washes before incubation with pre-chilled mouse anti-DnaK antibody (1:10,000 Ab in 3 % BSA and 0.01 % sodium azide in TBST; Enzo Life Sciences, Inc.) for one hour ...
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
Cat# HY-P7062-50 μg,
50 μg, USD $340.0
Ask
Xu Qiannan, et al.,
bioRxiv - Pathology 2020
Quote:
... Atopic dermatitis mouse model were established by applying 3 nmol MC903 (MedChemExpress, Cat. No.: HY-10001) each ear per day for 10 days ...
-
No products found
because this supplier's products are not listed.
CER Smith, et al.,
bioRxiv - Physiology 2023
Quote:
... ∼3 months (3M), ∼6 months (6M ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 3 kDa MWCO concentrator (Sartorius), and the protein concentration was estimated using a BCA assay.
-
No products found
because this supplier's products are not listed.
Matthew G. Zimmerman, et al.,
bioRxiv - Microbiology 2019
Quote:
... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...