-
No products found
because this supplier's products are not listed.
Edurne Mugarza, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Active Ras was measured using the Ras Activation Assay Kit from Millipore following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Quan Wu, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 1XB27 RA-(Gibco), in Dulbecco’s Modified Eagle Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Luca Carta, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... mouse mAb anti-human RAS (Cell Signaling Technology). Compounds SHY-855 and SHY-867 were synthesized at Enamine LLC (Kiev ...
-
No products found
because this supplier's products are not listed.
Swati Mishra, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Ras-related protein Rab-7a (Rab7) at 1:1000 (ab50533; Abcam); Ras-related protein Rab-11 (Rab11 ...
-
No products found
because this supplier's products are not listed.
Swati Mishra, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Ras-related protein Rab-11 (Rab11) at 1:250 (#610656; BD Biosciences); Lysosome associated membrane protein-1 (LAMP1 ...
-
No products found
because this supplier's products are not listed.
Dan Song, et al.,
bioRxiv - Cancer Biology 2022
Quote:
RAS activity was analyzed with a Ras Activation Assay Biochem Kit (Cytoskeleton, BK008). The QGY cell lines containing the control group ...
-
No products found
because this supplier's products are not listed.
Tricia T. Nguyen, Gia K. Voeltz,
bioRxiv - Cell Biology 2022
Quote:
... RA was PCR amplified from RA-NES (gift from R. Campbell, Addgene plasmid #61019) (Ding et al. ...
-
No products found
because this supplier's products are not listed.
Sara Fuentelsaz-Romero, et al.,
bioRxiv - Immunology 2021
Quote:
... serum and plasma of RA patients and healthy controls the Human CD14 Quantikine ELISA Kit (R&D Systems) was used.
-
No products found
because this supplier's products are not listed.
Birthe Dorgau, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Retinoic Acid (RA; 0.5 µM, Merck) was added from day 90 to day 120 of differentiation ...
-
No products found
because this supplier's products are not listed.
Diego Alem, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Ras GTPase Chemi ELISA Kit (Active Motif, 52097) was used to measure Ras GTPase level in organoids ...
-
No products found
because this supplier's products are not listed.
Leelavathi N Madhu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Ras (MyBioSource), p38 MAPK (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Sameer Farouk Sait, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Immunodetection of RAS proteins was carried out with pan-RAS (Ab-3; Calbiochem; 1:1,000) antibodies ...
-
No products found
because this supplier's products are not listed.
Lydia M. Castelli, et al.,
bioRxiv - Systems Biology 2021
Quote:
... All-Trans Retinoic Acid 0.1 µM (RA; StemCell Technologies) and Purmorphamine 0.5 µM (PMN ...
-
No products found
because this supplier's products are not listed.
Fangfang Song, et al.,
bioRxiv - Physiology 2023
Quote:
... and mouse Igf1 ELISA kit (Mouse IGF-1 ELISA Kit, Cat#80574, Crystal Chem). HOMA-IR was calculated as follows ...
-
No products found
because this supplier's products are not listed.
Lu Han, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2uM RA+ 2uM PMA (Tocris) is used for 2 days ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse IL1α ELISA Kit (Biolegend, #433404), Mouse CXCL5 ELISA Kit (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Matthew J. Brody, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... H-Ras (Santa Cruz Biotechnology, #sc-29, 1:500), integrin β1D (Millipore ...
-
No products found
because this supplier's products are not listed.
Megan E. Honeywell, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and Puromycin (#61-385-RA) was purchased from Corning. Pooled siGENOME siRNAs were purchased from Dharmacon/Horizon Discovery ...
-
No products found
because this supplier's products are not listed.
M. Bell, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Differentiation with RA & the brain-derived neurotrophic factor (BDNF, Peprotech) was adapted from former protocols56 ...
-
No products found
because this supplier's products are not listed.
Karl P. Schlingmann, et al.,
bioRxiv - Genetics 2021
Quote:
... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Moh’d Mohanad Al-Dabet, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Urine albumin was determined using a mouse albumin ELISA kit (Mouse albumin ELISA quantification kit, Bethyl Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Moon Hee Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and immunoblotting was performed to detected GTP-bound Ras proteins using anti-K-Ras antibody (Proteintech, 12063-1-AP), anti-RasG12D mutant specific antibody (Cell Signaling Technologies [CST] ...
-
No products found
because this supplier's products are not listed.
Baptiste Fischer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... RAS loaded with mant•GDP (RAS•mGDP) was obtained by mixing RAS with a 10x stochiometric excess of mGDP (Jena Bioscience) in a buffer containing an excess (20 mM ...
-
No products found
because this supplier's products are not listed.
Alexandra Blanco, et al.,
bioRxiv - Microbiology 2024
Quote:
... or 1μM retinoic acid (RA; Cayman Chemicals) + 1μM VitD for 72h as previously described (38 ...
-
No products found
because this supplier's products are not listed.
Hari Krishnamurthy, et al.,
bioRxiv - Immunology 2022
Quote:
The RA panel included anti-RF IgM (Roche Diagnostics ...
-
No products found
because this supplier's products are not listed.
Sieglinde Hastreiter, et al.,
bioRxiv - Physiology 2024
Quote:
ELISA: Insulin ELISA (Mouse Insulin ELISA, Mercodia) and Leptin ELISA (Quantikine Mouse/Rat Leptin Immunoassay ...
-
No products found
because this supplier's products are not listed.
Tana S. Pottorf, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Danielle M. Spice, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 14 and 17 after RA treatment using QIAshredder (Qiagen, 79654) and RNeasy (Qiagen ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Toshiya Kimura, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and detected with a CCD imager (RAS-4000; GE healthcare). The following primary antibodies were used ...
-
No products found
because this supplier's products are not listed.
Wei-Ching Chen, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Site-directed mutagenesis to generate the mutant RAS clones was performed with a QuikChange mutagenesis kit (Stratagene) and the primers for amino acid 180 site mutation of KRAS4A are CAGCAAAGAAGAAAAGACTCCTGGCAGTGTGAAAATT and AATTTTCACACTGCCAGGAGTCTTTTCTTCTTTGCTG.
-
No products found
because this supplier's products are not listed.
Katrin Manske, et al.,
bioRxiv - Bioengineering 2023
Quote:
... mice were anesthetized with 2.5% Isoflurane (RAS-4 Rodent Anesthesia system, Perkin Elmer) and 150 mg/kg body weight D-Luciferin-K-Salt (PJK GmbH ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Florian Wiede, et al.,
bioRxiv - Immunology 2019
Quote:
... the mouse anti-nuclear antibodies Ig’s (total IgA+G+M) ELISA Kit from Alpha Diagnostic Int. ...
-
No products found
because this supplier's products are not listed.
Lorenz Thurner, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit IL-1-Ra antibody (antibodies-online # ABIN2856394) followed by anti rabbit/POX 1:3000 (Biorad#170-6515) ...
-
No products found
because this supplier's products are not listed.
Maria F. Presti, Jeung-Hoi Ha, Stewart N. Loh,
bioRxiv - Biochemistry 2022
Quote:
... FN3SH2 and h-Ras genes were synthesized by GenScript (Piscataway, NJ). cpFN3SUMO and cpFN3WDR5 genes were synthesized by Eurofins Genomics (Louisville ...
-
No products found
because this supplier's products are not listed.
Malte S. Kaller, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse HMGB1(high mobility group protein B1) ELISA Kit from Elabscience (Houston, TX). The optical density readings obtained were used to generate a four-parameter logistic curve and the concentration of the analytes in the samples were calculated by comparing to the standard curve generated.
-
No products found
because this supplier's products are not listed.
Allison Knupp, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The following primary antibodies were used: Ras-related protein Rab-5A (RAB5A) at 1:500 (Synaptic Systems 108 011); early endosome antigen 1 (EEA1 ...
-
No products found
because this supplier's products are not listed.
Alice Laschuk Herlinger, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Total RNA from MB cells treated with RA for 48 h was extracted using the SV Total RNA Isolation System kit (Promega, Madison, USA), following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Giovanna Benvenuto, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The sequence encoding mCherry in frame with the polybasic sequence and CAAX motif of human K-Ras (GKKKKKKSKTKCVIM) for targeting to the plasma membrane was generated by amplification of mCherry using the pmCherry-N1 (Clontech) plasmid as template and the following primers ...
-
No products found
because this supplier's products are not listed.
Anouk Georges, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... libraries were also prepared using 50 ng of gDNA isolated from NaR P5 and 3D-RA DD25 cells by following the Nextera DNA Sample Preparation Guide (Illumina). The libraries were purified using the MinElute PCR purification kit (Qiagen ...
-
No products found
because this supplier's products are not listed.
Nikhil J. Parekh, et al.,
bioRxiv - Immunology 2019
Quote:
IFN-β protein was detected using the mouse Hi-Sensitivity IFN-β ELISA kit (PBL Assay Science). CCL4 protein was detected using the mouse CCL4/MIP-1 beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Tshegofatso Ngwaga, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Changrui Lu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The IgG ELISAs for RBD were conducted by using Antibody IgG Titer Serologic Assay Kit (AcroBiosystems, RAS-T059). According to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jessica K. Sawyer, et al.,
bioRxiv - Genetics 2019
Quote:
... pBID-UASC-FG-Ras plasmids were prepared with a ZymoPURE II Plasmid Midiprep Kit (Zymo Research) and sent to Model System Injections (Durham ...
-
No products found
because this supplier's products are not listed.
Hongyi Wu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... NM + 1 μM RA + 1 μΜ Purmorphamine (Miltenyi Biotec 130-104-465), was added and changed every other day until D17 ...
-
No products found
because this supplier's products are not listed.
Jacqueline Severino, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 0.1 mg/ml streptomycin and 100 nM all-trans Retinoic Acid (RA) (Enzo Life Sciences, BMLGR100).
-
No products found
because this supplier's products are not listed.
Stefanos Giannakopoulos, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse LH ELISA Kit (Abclonal Cat. # RK02986). All assays using normalized protein amounts were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marek Petráš, et al.,
bioRxiv - Microbiology 2020
Quote:
The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...