-
No products found
because this supplier's products are not listed.
Yisong Qian, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 papain-like protease (DB604) was purchased from Lifesensors (Malvern, PA). HCoV-HKU1 coronavirus nucleocapsid protein ...
-
No products found
because this supplier's products are not listed.
Jorge Morales, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated with a 1:1,000 dilution of mouse anti-GFP [B-2] (SantaCruz Biotechnology) or a rat anti-RFP [5F8] (Chromotek) followed by a 1:5,000 dilution of the horseradish peroxidase-conjugated secondary antibody against mouse IgG (7076 ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
12 well plate with tissue culture treated #1.5 glass-like polymer cover slip (0.175±0.010mm)....
Cat# P12-1.5P,
20/case, $221.00
Ask
Sonja Mihailovic, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and resuspended on 12-well plates with a glass-like polymer bottom (Cellvis) pre-coated with Matrigel at 37°C for two hours (Corning).
-
No products found
because this supplier's products are not listed.
Melissa Hingorani, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Mouse pups (C57BL/6, Charles River, PD 1-2) were anesthetized on ice ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50 μL of NBD-PL containing liposomes were diluted into 2 mL of buffer B in a disposable fluorescence cuvette (67.754.00002, SARSTEDT) at RT ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Yifei Dong, et al.,
bioRxiv - Immunology 2019
Quote:
... Total PC concentration was determined using the Phospholipase C assay kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Mei Zhang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Freshly dissected mouse brains were incubated in Golgi solution A and B (FD Rapid GolgiStain Kit, FD NeuroTechnologies) for 10 days ...
-
No products found
because this supplier's products are not listed.
Athina Kilpeläinen, et al.,
bioRxiv - Immunology 2021
Quote:
... The second ELISA was a commercially available IgM and IgG class antibody ELISA against the SARS-CoV-2 NP (ImmunoDiagnostics, Hongkong). Briefly ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Laura Schenkel, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5 the GFP-Like (Em 520/35) and DsRed-like (Em 617/73) Emission Filter Wheels and 2x Evolve 512 cameras (Photometrics; Tucson, Arizona, United States) were used ...
-
No products found
because this supplier's products are not listed.
Wenhui Qiao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Three putative sites with top CFD scores above 0.3 were identified and examined by Sanger sequencing (GENEWIZ) of PCR amplification products using extracted genomic DNA.
-
No products found
because this supplier's products are not listed.
Sarah Smith, Jessica Larsen,
bioRxiv - Pathology 2020
Quote:
... 4-methylumbelliferyl 6-sulfa-2-acetoamido-2-deoxy-b-D-glucopyranosidase (Toronto Research Chemicals, Cat. No. M335000, Ontario Canada), and 4-methylumbelliferyl N-acetyl b-D-glucosaminide (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Grégorie Lebeau, et al.,
bioRxiv - Immunology 2023
Quote:
... 2 mM L-glutamine and 0.5 μg·mL−1 amphotericin B (PAN Biotech, Dutsher, Brumath, France) and containing 10 µg·mL−1 blasticidin and 100−1 µg·mL zeocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Andrew J. Stout, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 10ng/mL insulin-like growth factor 1 (IGF-1; Shenandoah Biotechnology #100-34AF-100UG, Warminster, PA, USA) and 10 ng/mL epidermal growth factor (EGF ...
-
No products found
because this supplier's products are not listed.
Jeong Yeon Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Asserchrome D-dimer ELISA (#100947) from Stago (Asnières sur Seine, France) and Mouse total fibrinogen (#IMSFFBGKTT) from Innovative Research (Novi, MI) was used to analyse the samples in duplicates.
-
No products found
because this supplier's products are not listed.
Siavash Khosravi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... dried lipids were re-dissolved in 40% UPLC solvent B (90% 2-propanol/10% acetonitrile/0.1% formic acid/10 mM NH4HCO3) and transferred to silanized glass inserts (Phenomenex) using Hamilton syringes ...
-
No products found
because this supplier's products are not listed.
Hazel Stewart, et al.,
bioRxiv - Microbiology 2022
Quote:
... StrepMAB-Classic (1:500, mouse monoclonal, IBA lifesciences, 2-1507-001), anti-SARS-CoV-2 Spike (1:100 ...
-
No products found
because this supplier's products are not listed.
Anna Onnis, et al.,
bioRxiv - Immunology 2022
Quote:
... B (SEB; Toxin Technologies, #BT202) and E (SEE ...
-
No products found
because this supplier's products are not listed.
Joel Lang Yi Ang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and Rhodamine B (A5102, TCI) fluorescence stains were prepared at various concentrations for optimal staining of different tissue types ...
-
No products found
because this supplier's products are not listed.
Elliot Campbell, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody levels specific to Delta variant RBD were assessed in mouse sera by direct ELISA: plates were coated with 1 μg/ml Delta variant RBD (#S951-100, Leinco Technologies, Inc.) or MT-001 diluted in PBS and incubated at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Amol K. Bhandage, et al.,
bioRxiv - Immunology 2021
Quote:
... 100 U/ml streptomycin with 1000 U/ml mouse IL-2 (Immunotools). For mRNA expression by real-time quantitative PCR ...
-
No products found
because this supplier's products are not listed.
Toma Kashima, et al.,
bioRxiv - Biochemistry 2024
Quote:
... was used as the developing solvent and orcinol sulfate as the dyeing reagent.25) For galactose dehydrogenase-coupled assay,26,27) blood group B trisaccharide (2 mM; Biosynth Carbosynth, Compton, UK) was incubated with 1 μg/mL of the protein in 50 mM sodium acetate (pH 6.0) ...
-
No products found
because this supplier's products are not listed.
Xiao Du, et al.,
bioRxiv - Genomics 2020
Quote:
... (b) All SVs detected by PacBio CCS Reads and supported by either PacBio CLR or ONT were retained ...
-
No products found
because this supplier's products are not listed.
Aric N. Brown, et al.,
bioRxiv - Microbiology 2023
Quote:
... Polymyxin B (RPI Lot# 85594-90055) was added to cells triplicate96-well plates at a final concentration of 5.0µg/mL (C ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stephen R. Doyle, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed using the Trimmer-2 cDNA normalisation kit (Evrogen) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Hahn, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or with an inverted transmitted light microscope Axio Cellobserver Z1 equipped with MosaiX module for tile scanning and apotome for confocal like imaging (Carl Zeiss Microscopy, Germany). Photographs were analyzed using the free Fiji software (Schindelin et al. ...
-
No products found
because this supplier's products are not listed.
Anna V. Taubenberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... slides were incubated for 2 hours with secondary antibodies (Cy5-conjugated anti-mouse/rabbit IgG, Dianova) and Phalloidin-TRITC (Sigma ...
-
No products found
because this supplier's products are not listed.
Elisa Matas-Rico, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Granzyme B-PE (1:200, clone GB11, Sanquin Amsterdam). To detect cytokine production ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Antti M. Salo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse skin and kidneys using E.Z.N.A total RNA kit I (Omega Bio-Tek) for cells and TRIzol (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Arina V. Drobysheva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
For phi14:2 RNAP transcription assay genomic DNA of phi14:2 was purified using the Phage DNA Isolation Kit (Norgen Biotek Corp) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rebecca A Capel, et al.,
bioRxiv - Physiology 2019
Quote:
Male Dunkin Hartley guinea pigs (350-550g, Envigo or B&K Universal) were housed and maintained in a 12 h light-dark cycle with ad libitum access to standard diet and sterilised water ...
-
No products found
because this supplier's products are not listed.
Sherwin P. Montano, et al.,
bioRxiv - Biochemistry 2021
Quote:
... [Ta6Br12]2+ * 2 Br– (Jena Bioscience) for 1 to 5 days ...
-
No products found
because this supplier's products are not listed.
Anna-Leigh Brown, et al.,
bioRxiv - Neuroscience 2021
Quote:
TDP-43 inducible knockdown SH-SY5Y cells were electroporated with 2 μg of DNA with the Ingenio electroporation kit (Mirus) using the A-023 setting on an Amaxa II nucleofector (Lonza) ...