-
No products found
because this supplier's products are not listed.
Ghaidan A. Shamsan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Oncogene-injected animals were injected intraperitoneally with 100 µl of 28.5 mg/ml luciferin (GoldBio, St. Louis, MO) prior to imaging ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Stephanie Crater, et al.,
bioRxiv - Neuroscience 2022
Quote:
MR images of one mouse brain was acquired on a 30-cm bore 9.4T magnet (Bruker BioSpec 94/30, Billerica, MA). A high-sensitivity cryogenic RF surface receive-only coil was used for signal reception (Bruker CryoProbe) ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Roger Belizaire, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Oligonucleotides (Eton Bioscience, Boston, MA) used for generating sgRNA constructs and CBL cDNA mutagenesis are listed below:
-
No products found
because this supplier's products are not listed.
Jingjing Zhang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... qNano Gold (Izon Sciences, Boston, MA), was employed to quantify the size and concentration of EVs49 ...
-
No products found
because this supplier's products are not listed.
Shu-Yung Chang, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SW480 (Angio-Proteomie, Boston, MA, USA), and Caco-2 human colorectal adenocarcinoma cell line (ATCC ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Takeo Shibata, et al.,
bioRxiv - Immunology 2020
Quote:
... Cervical LBC samples (ThinPrep, Hologic, Marborough, MA) were collected for HPV typing before vaccination at the time of qualifying biopsy ...
-
No products found
because this supplier's products are not listed.
Tam Vo, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... was purchased from Absolute Antibody (Boston, MA). The expression and purification of the HNRNPH1 truncated proteins qRRM1-2 and qRRM2-3 (Creative BioMart ...
-
No products found
because this supplier's products are not listed.
Mee Jung Ko, et al.,
bioRxiv - Neuroscience 2020
Quote:
SNC80 (#076410, Tocris, Thermo Fisher Scientific, Waltham, MA) was diluted in slightly acidic saline pH5-6 ...
-
No products found
because this supplier's products are not listed.
Georgina Gyarmati, et al.,
bioRxiv - Physiology 2021
Quote:
... histological analysis of periodic acid-Schiff stain was performed on mouse kidney sections using PAS Stain Kit (24200-1, Polysciences, Warrington, PA). Images were visualized at 25× magnification using Leica TCS SP8 (Leica Microsystems ...
-
No products found
because this supplier's products are not listed.
Debajit Dey, et al.,
bioRxiv - Biophysics 2023
Quote:
... An LSM880 confocal microscope (Carl Zeiss Inc., Peabody, MA) was used to acquire images ...
-
No products found
because this supplier's products are not listed.
Pati Moloko Maindo, et al.,
bioRxiv - Microbiology 2019
Quote:
Serum samples were routinely screened for HBsAg using ELISA (Hepanostika® HBs, Biomérieux, France and Abbott GmbH & Co. KG, Wiesbaden, Germany), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jean-François Rivest, et al.,
bioRxiv - Genetics 2023
Quote:
... or from 30 mg of mouse liver using a EZ-10 Spin Column Animal Genomic DNA Miniprep Kit (Bio Basic, Markham, ON, CA), per the manufacturers’ recommendations ...
-
No products found
because this supplier's products are not listed.
Ramhari Kumbhar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-PAR (4335-MC-100; Trevigen), rabbit anti-pan PAR (MABE1016 ...
-
No products found
because this supplier's products are not listed.
Jeffrey L Hansen, Barak A Cohen,
bioRxiv - Genomics 2021
Quote:
... or goat anti-mouse (Epicypher #13-0048) polyclonal secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... 0.1 µg of mouse E1 (UBE1, Boston Biochem, Cambridge, MA, USA), and 1 µg of mouse E2 (UBE2E3 ...
-
No products found
because this supplier's products are not listed.
Aminata P. Coulibaly, et al.,
bioRxiv - Neuroscience 2019
Quote:
The arterial tree of each mouse was labeled using the vascular dye Microfil (Flow Tech, Carver, MA), and the cross-sectional MCA diameter was measured ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Jared D. Chrispell, Yubin Xiong, Ellen R. Weiss,
bioRxiv - Cell Biology 2022
Quote:
... Rabbit polyclonal antibodies against zebrafish Grk7 (27) and phosphorylated mouse Grk1 (17) were generated by 21st Century Biochemicals (Marlboro, MA, USA). A novel rabbit polyclonal antibody against phosphorylated zebrafish GRK1 was also generated by 21st Century Biochemicals using the peptide ISARG[pS]FDGTAN corresponding to amino acids 16-27 of zebrafish Grk1a ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Yaru Zhao, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... A Cell Counting Kit-8 (CCK-8) (Cat. no. K1018-30) was purchased from APExBIO (MA, USA). TRIzol™ reagent (Cat ...
-
No products found
because this supplier's products are not listed.
Aurelie de Rus Jacquet, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The number of CD63+ EVs collected in the EV-enriched fractions were estimated by ELISA (System Biosciences). The ELISA standards provided in the kit are calibrated by NTA to measure the number of exosomes and establish a standard curve based on exosome abundance ...
-
No products found
because this supplier's products are not listed.
Saed Abbasi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... synthesis of mRNA was carried out using MEGAscript™ T7 Transcription Kit (Waltham, MA, USA) with the addition of ACRA 5’ cap (Trilink biotechnologies) and m1Ψ-5’-triphosphate (Trilink biotechnologies ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Moshe T. Gordon, Brian P. Ziemba, Joseph J. Falke,
bioRxiv - Biophysics 2021
Quote:
... Lyophilized ATP was from Expedeon (Cambridge, MA). All other salts were from MilliporeSigma.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Seonhwa Lee, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Antibody stabilizer solution was purchased from Boca Scientific (Dedham, MA, USA).
-
No products found
because this supplier's products are not listed.
Marta Perera, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse ESCs were cultured in 8-wells slides (Ibidi). ESC immunostaining was carried out as previously described in Canham et al. ...
-
No products found
because this supplier's products are not listed.
William Bakhache, et al.,
bioRxiv - Microbiology 2021
Quote:
... The mouse anti-dsRNA antibody (J2) was from Jena Bioscience and rabbit anti-Calnexin from Elabscience ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Stetzik Lucas, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mouse coronal tissue sections were viewed under an Eclipse Ni-U microscope (Nikon); images were captured with a color Retiga Exi digital CCD camera (QImaging ...
-
No products found
because this supplier's products are not listed.
R Sánchez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The gel was soaked in 1× TAE buffer containing 0.5 μg/ml RedSafe (INtRON Biotechnology, Burlington, MA, USA) for 30 min and then visualized in a UV transilluminator.
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Tae Yeon Yoo, Timothy J Mitchison,
bioRxiv - Cell Biology 2020
Quote:
... and Ingenio® electroporation kit (#50117, Mirus). After 5 days of transfection ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...