-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cicera R. Lazzarotto, et al.,
bioRxiv - Genomics 2024
Quote:
... and L-glutamine (BioIVT), in plates coated with collagen type I (Sigma ...
-
No products found
because this supplier's products are not listed.
Hirak Saxena, et al.,
bioRxiv - Microbiology 2023
Quote:
All strains were grown in 2YT media (16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, BioShop Canada). NEB® Stable E ...
-
No products found
because this supplier's products are not listed.
Elena Kuzmin, et al.,
bioRxiv - Genomics 2023
Quote:
... 10 umol/L Y-27632 (Abmole), 50 ug/mL Gentamicin (Gibco) ...
-
No products found
because this supplier's products are not listed.
Cintya E. del Rio Hernandez, et al.,
bioRxiv - Systems Biology 2022
Quote:
... S-aminoethyl-L-cysteine hydrochloride (thyalisine) (Carbosynth), nourseothricin sulfate (Werner BioAgents) ...
-
Lenti/Retro virus
Cat# KC30796,
ViroMag RL 200µl + Magnetic Plate MF96000, USD $654.00/KIT
Ask
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 30μl of ViroMag R/L beads (OZ Biosciences) were added and incubated at room temperature for 15 minutes.35 During incubation 3×105 wild-type or CCR5-mut cells were placed in a single well of a 24-well plate and centrifuged at 530g for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
S protein (Cube Biotech #28703) and isolated platelets were mixed at final concentrations of 0.2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Kathy N. Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... Small volume l iquid handlers such as the Mosquito HTS (TTP LabTech) and Mantis (Formulatrix ...
-
No products found
because this supplier's products are not listed.
Natalie Vandepol, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1 g/L Bacto Yeast Extract (Difco, Thomas Scientific; New Jersey, USA)] ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Kristine L Trotta, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was transferred to nitrocellulose (0.2µm; GVS) via semi-dry transfer with a TransBlot Turbo transfer system (BioRad ...
-
No products found
because this supplier's products are not listed.
Mingyu Fang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... gels were either stained with Coomassie (Protein Ark) or transferred to PVDF membranes for Western blot analysis.
-
No products found
because this supplier's products are not listed.
Elizabeth Vincent, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and CFP protein (Anti-GFP; Aves labs #GFP-1010) using the immunofluorescence assay described above ...
-
No products found
because this supplier's products are not listed.
Eleni Kafkia, et al.,
bioRxiv - Systems Biology 2020
Quote:
... mouse anti-lamin B1 (1:500, Atlas Antibodies, AMAb91251) and anti-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Cheng-Ji Li, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The animals were anesthetized with isoflurane (airflow: 0.8-1.0 L/min, 0.5-3% isoflurane mixed with oxygen, adjusted according to physiological monitoring, RWD Life Science). Their body temperature was maintained at approximately 38 using a heating pad underneath the body with a closed-loop controller connected to a rectal temperature probe ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Michael J. Gray,
bioRxiv - Microbiology 2020
Quote:
... I added 250 µl of 95% ethanol to the remaining sample and applied the resulting mixture to an EconoSpin silica spin column (Epoch Life Science), rinsed with 750 µl 5 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Hannah E Roberts, et al.,
bioRxiv - Genetics 2020
Quote:
2 μg of lymphoma DNA was thawed fragmented in 49 μl of Nuclease Free Water (NFW) for 2 minutes at 7,000 revolutions per minute (rpm) using g-TUBE (Covaris®, Woburn, MA, USA) following manufacturer recommendations ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
Rabbit polyclonal antibody to PCMT1
Cat# CQA1444,
200 ul USD $350.0, 100 ul USD $220.0, 50 ul USD $150.0
Ask
Yingjuan Liu, et al.,
bioRxiv - Genetics 2020
Quote:
... Secondary antibodies used for IF were goat-anti-mouse H&L FITC (Cohesion Biosciences) or goat-anti-rabbit H&L FITC (Cohesion Biosciences) ...
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2022
Quote:
... L-778123 (TargetMol), AZD1208 (Tocris Bioscience) ...
-
No products found
because this supplier's products are not listed.
Anna-Maria Möller, et al.,
bioRxiv - Microbiology 2023
Quote:
... L-161,240 (AdooQ), BB-78485 (Aobius) ...
-
No products found
because this supplier's products are not listed.
Ankita M. George, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse monoclonal antibody targeting the nucleocapsid protein of CDV (CDV-NP, VMRD, WA, USA) was used at a dilution of 1:2000 (60 min incubation) ...
-
No products found
because this supplier's products are not listed.
S. Jordan Kerns, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 mmol/L CHIR99021 (ReproCell) and 50 mg/mL primocin (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Kristen M. Consalvo, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 15 g/L agar (Hardy Diagnostics)) (Sussman ...
-
No products found
because this supplier's products are not listed.
Yang Dong, et al.,
bioRxiv - Biophysics 2022
Quote:
... buffer was replaced with fresh buffer containing unlabeled L-serine and 0.1 Ci of [14C] L-serine (Moravek Biochemicals ...
-
No products found
because this supplier's products are not listed.
Katrina B. Velle, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were cultured axenically in M7 Media (10% FBS + 45 mg/L L-methionine + 5 g/L yeast extract + 5.4 g/L glucose + 2% (v/v) M7 Buffer (18.1 g/L KH2PO4 + 25 g/L Na2HPO4)) in plug seal tissue culture-treated flasks (CELLTREAT; cat. no. 229330) and grown at 28°C ...
-
No products found
because this supplier's products are not listed.
Kristin D. Dahl, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... MBP (Myelin Basic Protein, Neuromics Cat # ...
-
No products found
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... or mouse anti-VP5 (Biodesign. International) 1:500 ...
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Yuki Muroyama, et al.,
bioRxiv - Immunology 2022
Quote:
... HiFi SpCas9 protein (SpyFiTM) was purchased commercially (Aldevron) and aliquoted to avoid frequent freeze/thawing.
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...