-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
... N protein was detected using the SARS-CoV-2 NP ELISA kit from Bioss (cat# BSKV0001) according to the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Yfat Yahalom-Ronen, et al.,
bioRxiv - Microbiology 2020
Quote:
... L and G proteins (Kerafast), all of which under T7 promoter control ...
-
No products found
because this supplier's products are not listed.
Geneviève Jolivet, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Anti Müllerian hormone levels were determined in 50 μl aliquots of serum samples by using an ELISA kit (AMH GenII ELISA, with AMH Gen II calibrators and controls, Beckman Coulter, Villepinte, France) as previously described (Bourdon et al ...
-
No products found
because this supplier's products are not listed.
S. Elizarova, et al.,
bioRxiv - Neuroscience 2021
Quote:
... For L-3,4-Dihydroxyphenylalanine (L-DOPA, Tocris Bioscience) treatment ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Jing Shao, et al.,
bioRxiv - Physiology 2022
Quote:
... Protein concentration was determined using BCA Protein Assay Kit (TIANGEN) and diluted in loading dye (β-mercaptoethanol 5% ...
-
No products found
because this supplier's products are not listed.
Sarah K. Schultz, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cell opening and fluorescent labeling of L-AHA-containing proteins with DBCO-PEG4-Carboxyrhodamine 110 (Click Chemistry Tools) were performed as described 29 ...
-
No products found
because this supplier's products are not listed.
David Tomaz, et al.,
bioRxiv - Immunology 2022
Quote:
... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... KLK10 in mouse plasma was measured by using a mouse KLK10 ELISA kit (Antibodies-online, ABIN628061).
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
Sinéad Kinsella, et al.,
bioRxiv - Immunology 2023
Quote:
... Gasdermin D was measured in freshly isolated thymocytes using Gasdermin D (mouse) ELISA Kit (Adipogen Life Sciences, AG-45B-0011-KI01). Lactate dehydrogenase was assessed from the supernatant of harvested thymocytes using Lactate Dehydrogenase assay (Abcam ...
-
No products found
because this supplier's products are not listed.
Richik Nilay Mukherjee, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1:10 Goat-Anti-Mouse IgG (H+L) (EMS 25133) antibodies coupled with 6 nm and 15 nm gold particles ...
-
No products found
because this supplier's products are not listed.
Wajihul Hasan Khan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Protein expression was scaled-up in a 1.3 L bioreactor (Eppendorf, USA) with 0.5 L initial volume ...
-
No products found
because this supplier's products are not listed.
Frauke Muecksch, et al.,
bioRxiv - Immunology 2022
Quote:
... The developing reaction was stopped by adding 50 μl of 1 M H2SO4 and absorbance was measured at 450 nm with an ELISA microplate reader (FluoStar Omega, BMG Labtech) with Omega and Omega MARS software for analysis ...
-
No products found
because this supplier's products are not listed.
Ana Martínez-Riaño, et al.,
bioRxiv - Immunology 2020
Quote:
... the PolyLink Protein Coupling Kit (Polysciences) was used as indicated by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Neil G. Rumachik, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... FRG mice were maintained on irradiated high-fat low-protein mouse chow (Envigo Teklad Global 16% Protein Cat#2916) ad libitum to decrease flux through the tyrosine pathway ...
-
No products found
because this supplier's products are not listed.
Benjamin W Bauer, et al.,
bioRxiv - Microbiology 2019
Quote:
... L-cysteine (0.5 g/L, Alfa Aesar), resazurin sodium salt (5 mg/L ...
-
No products found
because this supplier's products are not listed.
Haoyuan Jing, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Endogenous Bassoon protein was stained by an anti-bassoon mouse monoclonal (Synaptic Systems) antibody ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and/or Clean Cap®Cyanine5 (Cy5) Enhanced Green Fluorescent Protein mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7701).
-
No products found
because this supplier's products are not listed.
Dat P. Truong, et al.,
bioRxiv - Biochemistry 2022
Quote:
L-Ala-L-Glu was commercially purchased (Chem Impex Int’l, Inc) and L-Ala-D-Glu was synthesized as described previously [16] ...
-
No products found
because this supplier's products are not listed.
Axel Pahl, et al.,
bioRxiv - Cell Biology 2023
Quote:
... were cultured in Dulbecco’s Modified Eagle’s medium (DMEM with 4.5 g/L Glucose, L-glutamine and 3.7 g/L sodium bicarbonate; PAN Biotech, #P04-03550) supplemented with 10% of fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Md Nasful Huda Prince, et al.,
bioRxiv - Biophysics 2023
Quote:
... a fixed whole brain of Thy1-YFP-H Tg mouse was treated with the commercialized CUBIC-L (Tokyo Chemical Industry, Japan, #T3740) at 37°C for 4 days ...
-
No products found
because this supplier's products are not listed.
Anne Chouquet, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Protein L biosensors (Pall/FortéBio) or lab-made IgM-specific biosensors were tested ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Changjun Yang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Adropin levels in mouse plasma were quantified using an ELISA kit (Cat. No. EK-032-35, Phoenix Pharmaceuticals, Inc., Burlingame, CA) as recommended by the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Mustafa Burak Acar, et al.,
bioRxiv - Microbiology 2022
Quote:
FASP Protein Digestion Kit (Expedeon, UK) was used in the sample preparation process ...
-
No products found
because this supplier's products are not listed.
Riti Gupta, Dmitri Toptygin, Christian M. Kaiser,
bioRxiv - Biochemistry 2020
Quote:
... and protein expression was induced with final concentration of 0.2% (w/v) L-arabinose (AMRESCO) at 37°C when OD600 reached 0.4~0.6 ...
-
No products found
because this supplier's products are not listed.
David Hoffmann, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Purification of the mouse lectin-mIgG2a fusion proteins was performed using Protein A agarose resin (Gold Biotechnology, P-400-5). The protein A beads were pelleted at 150g for 5 min and washed once with 1x binding buffer (0.02 M Sodium Phosphate ...
-
No products found
because this supplier's products are not listed.
Marco Di Gioia, et al.,
bioRxiv - Immunology 2023
Quote:
... Total protein concentrations were determined using BCA protein assay kit (Genesee Scientific, Cat# 18-440). Proteins were separated using SDS-PAGE electrophoresis and then transferred to polyvinylidene difluoride (PVDF ...
-
No products found
because this supplier's products are not listed.
Wei-Li Ling, Samuel Ken-En Gan,
bioRxiv - Immunology 2022
Quote:
KD measurements of the Pertuzumab and Trastuzumab IgMs to their Her2 antigen (Cat: 10004-HCCH, SinoBiological) were performed by first immobilizing them on Protein L (Cat: 18-5085, Sartorius) and CaptureSelect™ Biotin Anti-IgM Conjugate (Cat ...
-
No products found
because this supplier's products are not listed.
Umut Berkay Altıntaş, et al.,
bioRxiv - Genomics 2023
Quote:
... Preclearing 30μl of Dynabeads protein A/G for 1 h at 4 °C was followed by incubation with antibodies (H3K27ac, Diagenode, 3C15410196 ...
-
No products found
because this supplier's products are not listed.
Maïté Courel, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...
-
No products found
because this supplier's products are not listed.
Mohammad Zeeshan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Immunoprecipitation was performed using the protein lysates and a GFP-Trap_A Kit (Chromotek) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jimmy Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... The antibodies used for immunostaining and ELISA were mouse anti-Meth antibody (mouse, 10M25A Fitzgerald), anti-MBD2 (ab45027 ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Barbara Summers, et al.,
bioRxiv - Pathology 2023
Quote:
... and anti-collagen I and II in mouse BAL was done using a commercially available ELISA on a 96-well plate (Chondrex) and a plate reader ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
Jean-Christophe Beltra, et al.,
bioRxiv - Immunology 2022
Quote:
... injections of 200μl of PBS containing or not rat anti-mouse PD-L1 monoclonal antibody (200μg/injection, clone 10F.9G2, BioXcell) were performed every three days between days 22 and 34 for a total of five injections ...
-
No products found
because this supplier's products are not listed.
Luke Isbel, et al.,
bioRxiv - Genomics 2022
Quote:
Mouse ES cells were seeded on poly-L-lysine -coated 8-well (3*10^4 cells/well) μ-Slides (Ibidi) and left for 4 hours before the media was exchanged with fresh media and containing 1 µM doxorubicin (#44583 ...
-
An aqueous solution with toluene added as a preservative.
Cat# LS002764,
5 mg, $178.00
Ask
William J. Nicolas, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.2g/L cellulase (Worthington, purified exo- and endo-glucanases ...
-
No products found
because this supplier's products are not listed.
Anissa A. Widjaja, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the telomere length and mitochondrial copy number for mouse tissues were evaluated by RT-qPCR with the Relative Mouse Telomere Length Quantification qPCR Assay Kit (M8908, ScienCell) and Relative Human Mitochondrial DNA copy number Length Quantification qPCR Assay Kit (M8938 ...
-
No products found
because this supplier's products are not listed.
Asad U Malik, et al.,
bioRxiv - Biochemistry 2022
Quote:
... L-α-Phosphatidylserine (#840032C) and L-α-Diacylglyerol (#800815C) were purchased from Avanti Polar Lipids, Inc ...