-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Pcmt1 (rabbit polyclonal, Abcam 1:1000), GAPDH (Invitrogen 1:1000).
-
No products found
because this supplier's products are not listed.
Ryan Finethy, et al.,
bioRxiv - Immunology 2020
Quote:
... The following ELISA kits were used: IL-1β Mouse ELISA kit (ThermoFisher), IL-18 Mouse ELISA kit (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Hyeung Ju Park, et al.,
bioRxiv - Immunology 2023
Quote:
... The following ELISA kits were used: TSLP mouse ELISA kit (EMTSLP; Thermo) and Mouse IL-33 Quantikine ELISA kit (M3300; R&D system). All samples were assessed in triplicate.
-
No products found
because this supplier's products are not listed.
Fangfang Song, et al.,
bioRxiv - Physiology 2023
Quote:
... and mouse Igf1 ELISA kit (Mouse IGF-1 ELISA Kit, Cat#80574, Crystal Chem). HOMA-IR was calculated as follows ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse IL1α ELISA Kit (Biolegend, #433404), Mouse CXCL5 ELISA Kit (R&D Systems ...
-
No products found
because this supplier's products are not listed.
José Ursic-Bedoya, et al.,
bioRxiv - Physiology 2021
Quote:
... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
No products found
because this supplier's products are not listed.
Sieglinde Hastreiter, et al.,
bioRxiv - Physiology 2024
Quote:
ELISA: Insulin ELISA (Mouse Insulin ELISA, Mercodia) and Leptin ELISA (Quantikine Mouse/Rat Leptin Immunoassay ...
-
No products found
because this supplier's products are not listed.
Moh’d Mohanad Al-Dabet, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Urine albumin was determined using a mouse albumin ELISA kit (Mouse albumin ELISA quantification kit, Bethyl Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tana S. Pottorf, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Insulin and leptin levels were measured using Mouse Ultrasensitive Insulin ELISA and Mouse/Rat Leptin ELISA kits (ALPCO) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Alex Steimle, et al.,
bioRxiv - Microbiology 2023
Quote:
... we used the Mouse Tight junction protein ZO-1 ELISA Kit (MyBioSource, #MBS2603798) and the Mouse Occludin (OCLN ...
-
No products found
because this supplier's products are not listed.
Leena Sapra, et al.,
bioRxiv - Immunology 2021
Quote:
... Protein transport inhibitor cocktail and Mouse TNF-α (560478) ELISA kit were procured from BD (USA). The following ELISA kits were brought from R&D ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse HMGB1(high mobility group protein B1) ELISA Kit from Elabscience (Houston, TX). The optical density readings obtained were used to generate a four-parameter logistic curve and the concentration of the analytes in the samples were calculated by comparing to the standard curve generated.
-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Pathology 2024
Quote:
... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
No products found
because this supplier's products are not listed.
Nikhil J. Parekh, et al.,
bioRxiv - Immunology 2019
Quote:
IFN-β protein was detected using the mouse Hi-Sensitivity IFN-β ELISA kit (PBL Assay Science). CCL4 protein was detected using the mouse CCL4/MIP-1 beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Tshegofatso Ngwaga, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marina A. Schapfl, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Cayman’s Anti-Ovalbumin IgG1 (mouse) ELISA Kit (Cayman Chemical, Ann Arbor, MI, USA, 500830) was used according to manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Stefanos Giannakopoulos, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse LH ELISA Kit (Abclonal Cat. # RK02986). All assays using normalized protein amounts were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xilin Wu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the protein was coated to high protein-binding ELISA plates (Corning) at a concentration of 0.5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Ryosuke Hiwa, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse anti-dsDNA IgG-specific ELISA Kit was from Alpha diagnostic. Mouse IL-2 DuoSet ELISA DuoSet and Ancillary Reagent Kit 2 were from R&D Systems.
-
No products found
because this supplier's products are not listed.
Yuxin Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... G-CSF was quantified by Mouse G-CSF ELISA Kit (Proteintech) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Feng Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... TNF-α protein level was measured by using an ELISA kit from PeproTech (#900-K25) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bhagawati Jalnapurkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Neurofilament light chain (NF-L) was quantified using Mouse NF-L ELISA Kit (Novus Biologicals, Catalog #NBP2-80299) and read on a SpectraMax iD5 (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A corticosterone ELISA kit (Enzo Life Sciences) was used to quantify corticosterone levels in blood serum samples ...
-
No products found
because this supplier's products are not listed.
Acharya Balkrishna, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... CB-Protein Assay kit and MCP-1 ELISA kit from G-Biosciences, India ...
-
No products found
because this supplier's products are not listed.
Marek Petráš, et al.,
bioRxiv - Microbiology 2020
Quote:
The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
No products found
because this supplier's products are not listed.
Richard de Reuver, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
No products found
because this supplier's products are not listed.
Yibo Yin, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Wenjing Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... Quantitation of urinary albumin and creatinine was carried out using mouse albumin-specific ELISA kits (Roche) and creatinine determination kits (Enzymatic Method ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Abulaish Ansari, et al.,
bioRxiv - Physiology 2023
Quote:
... and apoB (Mabtech ELISA Kits) in triplicate ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
... SARS-CoV-2 spike protein-specific IgG was measured using SARS-CoV2 spike protein serological IgG ELISA kit (Cell Signaling Technology) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Meredith A. Jackson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Mouse PAF ELISA kits were purchased from LifeSpan Biosciences (Seattle, WA, USA). Plasma samples were assayed in duplicate according to kit manual using 50 µL samples in each well ...
-
No products found
because this supplier's products are not listed.
Christophe Huret, et al.,
bioRxiv - Immunology 2024
Quote:
... 96-well ELISA plates were coated with 1 μg/mL of goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories) in PBS for 2 hours at 37 °C then overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Rachel M. Stewart, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the Mouse-on-Mouse (MOM) Immunodetection kit Blocking Reagent and Protein Diluent (Vector Laboratories) were used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kevin R. Bewley, et al.,
bioRxiv - Pathology 2020
Quote:
... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ...
-
No products found
because this supplier's products are not listed.
José Ursic-Bedoya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and protein quantification was assayed using human FGF19 ELISA kit (Biovendor, RD191107200R). Protein was then diluted 1:2 in PBS+0.2%BSA and stored at - 20°C.
-
No products found
because this supplier's products are not listed.
Lei Peng, et al.,
bioRxiv - Immunology 2021
Quote:
... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
No products found
because this supplier's products are not listed.
Hazel Tye, et al.,
bioRxiv - Immunology 2023
Quote:
... Insulin and NEFA levels were using a mouse insulin ELISA kit (Promega) and WAKO NEFA-C kit (WAKO ...
-
No products found
because this supplier's products are not listed.
Mithu Baidya, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 μl of pre-equilibrated Protein L (Capto L, GE Healthcare) beads (20mM HEPES ...
-
No products found
because this supplier's products are not listed.
Ian A. Windham, et al.,
bioRxiv - Cell Biology 2023
Quote:
... donkey anti-mouse IgG (H+L) (H+L) IRDye 800CW (1:15,000 WB; LI-COR Biosciences Cat# 926-32212,
-
No products found
because this supplier's products are not listed.
Chen Zhang, et al.,
bioRxiv - Physiology 2022
Quote:
... anti-PCMT1 (sc-100977) antibodies and LPS (sc-3535) were from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Miho Araki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... An Sftpc ELISA kit for the mouse was purchased from Aviva Systems Biology (OKEH01170) ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
C-Reactive Protein ( CRP ) ELISA / Assay Kit
Cat# K069-H5,
1.0 ea, USD $1520.0
Ask
Anthony G. Pacholko, Lane K. Bekar,
bioRxiv - Neuroscience 2019
Quote:
Fecal pellets were collected from the colon during sacrifice and immediately stored on dry ice for subsequent ethanol extraction (100 μL ethanol/10 mg fecal powder) and equal volume measurement of corticosterone metabolites using an ELISA-based Assay Kit (Arbor Assays). Fecal samples were chosen over serum as they better represent a long-term average less influenced by rapid stress-induced changes in corticosterone expression ...
-
No products found
because this supplier's products are not listed.
Francesco De Virgiliis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 100 µl of lysate (corresponding to 80 mg of proteins) were analysed with the Multi-Neurotrophin Rapid Screening ELISA kit (Biosensis), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gustavo W. Fernandes, et al.,
bioRxiv - Physiology 2020
Quote:
... Plasma insulin level was obtained using Insulin (Mouse) ELISA Kit (Abnova). Acetyl Co-A levels in the liver and cells were obtained using the Acetyl-CoA Fluorometric Assay Kit (Biovision).
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...