-
No products found
because this supplier's products are not listed.
Patricia G. Izquierdo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... elegans cDNA library (OriGene) using 5’ AGAGAGAATGATGTTAGGAGG 3’ and 5’ AGTTGAAAATGAAAGAATAATGG 3’ (55°C annealing temperature ...
-
No products found
because this supplier's products are not listed.
Joana Rajão-Saraiva, et al.,
bioRxiv - Neuroscience 2022
Quote:
... presenilin-1 [PSEN1] and microtubule-associated protein tau [MAPT]) (Mutant Mouse Research and Resource Center at The Jackson Laboratory) was used as control.
-
No products found
because this supplier's products are not listed.
Danilo Correa Pinto Junior, et al.,
bioRxiv - Physiology 2023
Quote:
... Mouse circulating osteocalcin was measured by ELISA (Quidel kit Cat #60-1305). Blood testosterone levels were determined by RIA (Testo-US Cisbio Bioassays) ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Diane Maurice, et al.,
bioRxiv - Immunology 2023
Quote:
... purified CD8+ T-cells were coated with mouse IL-2 catch reagent from a mouse IL-2 secretion assay detection kit (Miltenyi Biotec) by incubating T cells in a 20x dilution of IL-2 catch reagent in R10 medium for 15 min on ice ...
-
No products found
because this supplier's products are not listed.
Kazuto Kawamura, Ichiro N. Maruyama,
bioRxiv - Genetics 2019
Quote:
... elegans DNA was sequenced using the MiSeq platform (Illumina, San Diego, CA). Libraries were prepared with an Illumina TruSeq Library Prep Kit ...
-
No products found
because this supplier's products are not listed.
Na Zhao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Untreated 2153L and 2151R tumors were dissociated in 1 mg/ml Collagenase A for 2 hrs at 37°C and TAMs were separated using EasySep™ Mouse F4/80 Positive Selection Kit (STEMCELL technologies, #100-0659) following manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Clara Hozer, Fabien Pifferi,
bioRxiv - Physiology 2021
Quote:
... We assayed plasma 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels (OxiSelect™ Oxidative DNA Damage Elisa kit, Cell Biolabs Inc.) and insuline-like growth-factor 1 (IGF-1 ...
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miho Araki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... An Sftpc ELISA kit for the mouse was purchased from Aviva Systems Biology (OKEH01170) ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Adam J. Rocker, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA color development was monitored with an ELISA plate reader (BioTek Synergy 2 Multi-Mode Reader) at 405 nm with wavelength correction set at 650 nm ...
-
No products found
because this supplier's products are not listed.
Poshen B. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
We transduced cells with lentivirus carrying KRAB-dCas9 and sgRNA targeting candidate progrowth enhancers and performed puromycin (2 μg/ml) (InvivoGen) for three days postelectroporation to select against non-transduced cells ...
-
No products found
because this supplier's products are not listed.
Giorgia Cimato, et al.,
bioRxiv - Microbiology 2024
Quote:
... and incubated with an anti-IE1/2 antibody for 2 hours at 37°C and an HRP-conjugated rabbit anti-mouse secondary antibody (Jackson ImmunoResearch, Cambridge, UK) for 45 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Surendra Raj Sharma, et al.,
bioRxiv - Immunology 2023
Quote:
... and ELISAs were detected with HRP-conjugated goat-anti-mouse IgG1-HRP (Southern Biotech). To develop the enzymatic reaction TMB was used as described above ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...
-
No products found
because this supplier's products are not listed.
Elisa Vaiani, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... inhibin B and AMH/MIS by 2-site ELISA (Beckman Coulter and Beckman Coulter Gen II ...
-
No products found
because this supplier's products are not listed.
Jeremy A. Herrera, et al.,
bioRxiv - Biochemistry 2019
Quote:
... then 60 °C for 2 hours while shaking at 1400 RPM (Eppendorf, ThermoMix C). To select for ECM proteins ...
-
No products found
because this supplier's products are not listed.
Yafei Qu, et al.,
bioRxiv - Microbiology 2020
Quote:
... mouse SARS-CoV-2 N (GeneTex, #GTX635689), and mouse GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Pragya D Yadav, et al.,
bioRxiv - Microbiology 2021
Quote:
... Briefly, ACE-2 protein (Acro Biosystems, USA) was coated onto ELISA plates (Greiner, Germany) at 1 μg/mL concentration in PBS and was incubated (for 12-72 hours ...
-
No products found
because this supplier's products are not listed.
Bahia Bekhouche, et al.,
bioRxiv - Genetics 2019
Quote:
... followed by a 30 min incubation with signal enhancer Amplify NAMP100 (GE Healthcare). The radiolabeled products were revealed using Typhoon phosphoimager.
-
Mouse Presenilin Enhancer 2 Homolog (C. Elegans) (PSENEN) ELISA Kit is an ELISA Kit for the in...
Cat# abx556128-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alice V. R. Lake, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Smoothened homolog (Bioss antibodies, bs-2801R).
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
M. Giovannetti, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... elegans animals were transferred to 2 ml MN Bead Tubes Type A (Macherey-Nagel, Düren, Germany) and lysed using a Precellys Bead Beating system with an additional Cryolys cooling module (Bertin Instruments ...
-
No products found
because this supplier's products are not listed.
Shuai-Qi Liu, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... After fluorounce enhancer (Epigentek) and fluorounce developer (Epigentek ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... C1q mouse ELISA (Hycult Biotech, HK211-01), Total C4 (LSBio ...
-
No products found
because this supplier's products are not listed.
Tomoki Togashi, et al.,
bioRxiv - Bioengineering 2023
Quote:
... hPC antigen (hPC:Ag) was measured using the Human Protein C AssayMaxTM ELISA Kit (Assaypro, St. Charles, MO) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
D’Juan T. Farmer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... All primary/secondary antibodies were diluted in SignalBoost™ Immunoreaction Enhancer Kit (407207–1KIT, Calbiochem). After three washes in PBS ...
-
No products found
because this supplier's products are not listed.
M Gueuning, et al.,
bioRxiv - Genetics 2024
Quote:
... we added 1 M of Betaine enhancer (VWR) per reaction ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Krzysztof Pyrć, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
No products found
because this supplier's products are not listed.
Rafael K. Campos, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.1 mg/mouse of anti-mouse CD3ε F(ab’)2 fragments (clone 145-2C11, BioXCell) or control f(ab’)2 fragments of polyclonal hamster IgG (BioXCell ...
-
No products found
because this supplier's products are not listed.
Feng Li, et al.,
bioRxiv - Genetics 2019
Quote:
A Hi-C library was constructed with the ProxiMeta Hi-C kit from Phase Genomics v 1.0 containing the enzyme Sau3A ...
-
No products found
because this supplier's products are not listed.
Jennifer L. Reedy, et al.,
bioRxiv - Immunology 2023
Quote:
... For the R&D Duoset kits the ELISA were read using an i3X Spectrophotometer (Molecular Devices, LLC). For the LegendPlex assays ...
-
No products found
because this supplier's products are not listed.
Meagan N. Esbin, et al.,
bioRxiv - Cell Biology 2024
Quote:
... + 1:1000 Enhancer (Biotium) and incubated for ∼10-15min before starting imaging ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Anthoni M. Goodman, et al.,
bioRxiv - Neuroscience 2020
Quote:
Male and female TgF344-AD rats harboring the human Swedish amyloid precursor protein (APPswe) and delta exon 9 mutant presenilin-1 (PS1ΔE9) were bred with non-transgenic F344 females (Envigo, Indianapolis ...
-
No products found
because this supplier's products are not listed.
Jamie Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... elegans Fosmid Library (Source BioScience) and were amplified in bacteria using CopyControl Induction Solution (Lucigen, #CCIS125) and purified using a DNA midi prep kit (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Sang-Ho Song, George J. Augustine,
bioRxiv - Neuroscience 2023
Quote:
... mouse anti-synaptobrevin 2 (104 211, Synaptic Systems), mouse anti-sodium potassium ATPase (ab7671 ...
-
No products found
because this supplier's products are not listed.
Mizuki Kurashina, et al.,
bioRxiv - Neuroscience 2020
Quote:
... elegans using a Zeiss LSM800 Airyscan confocal microscope (Carl Zeiss, Germany) with oil immersion lens 63x magnification (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Maternal serum samples collected at 0.6 G were analyzed for C-reactive protein (CRP) using an hsCRP ELISA kit (MP Biomedicals, Solon, OH) according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Lin- c-Kit+ cells were sorted into 2%FCS-PBS with 100µM IWR-1 (Tocris, 3532) or control vehicle ...
-
No products found
because this supplier's products are not listed.
Senthilvelrajan Kaniyappan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... covered with either 2 nm amorphous carbon (Quantifoil, R2/1+2 nm C) or graphene were used for sample preparation ...