-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
Mouse monoclonal antibody specific for Toxoplasma gondii SAG-1 (6207)
Cat# MAB12296-100,
100µg USD $305.35
Ask
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2021
Quote:
... HNoV GII.4 virus-like particles (VLPs) were purchased from The Native Antigen Company, Poly (I:C ...
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
magnetofection
difficult to transfect cells
Cat# KC30296,
PolyMag 100µL+PolyMag Neo100µL+ CombiMag 100µL+Magnetic Plate MF96000, USD $640.63/KIT
Ask
Andrew S. Flies, et al.,
bioRxiv - Immunology 2020
Quote:
... Digested proteins in PBS were diluted 1:1 in Squalvax (Oz Biosciences # SQ0010) to a final concentration of 0.1 μg/μL and was mixed using interlocked syringes to form an emulsion ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Milou W.M. Meeuse, et al.,
bioRxiv - Systems Biology 2020
Quote:
... we replaced the previous 3.5- cm dishes with a “sandwich-like” system: The bottom consisted of a glass cover slip onto which two silicone isolators (GRACE Bio-Labs, SKU: 666103) with a hole in the middle were placed on top of each other and glued onto the glass cover slip ...
-
No products found
because this supplier's products are not listed.
Dennis S. Metselaar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... glial fibrillary acidic protein (GFAP) (1:500; BT46-5002–04, BioTrend), S100 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Miho Matsuda, Chih-Wen Chu, Sergei Y. Sokol,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-DYKDDDDK mAb clone 2H8 (Cosmo Bio USA, #KAL- K0602, 1:1000) and mouse anti-GFP mAb clone B2 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Xuan Yang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Mouse cryopreserved hepatocytes were supplied by BioIVT (lot ZPG, pooled male CD-1). Vials of cryopreserved hepatocytes were removed from storage and thawed in a 37°C water bath with gently shaking ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... the arrays were probed at 1/100 dilution in protein array blocking buffer (GVS) supplemented with E ...
-
No products found
because this supplier's products are not listed.
Mariano Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
Blots were incubated with antibodies (1/3000 dilution) purified on G-protein (Proteogenix, France), followed by horseradish peroxidase-conjugated (HRP ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Malika Aid, et al.,
bioRxiv - Microbiology 2021
Quote:
... at 1:1000 detection using Mouse Polink-2 HRP (GBI Labs Cat. No. D37-110). Staining for MPO and Mx1 IHC was performed as previously described using a Biocare intelliPATH autostainer ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Bastien Casu, et al.,
bioRxiv - Microbiology 2022
Quote:
... Streptomyces cells were mixed with 10 nm Protein A conjugated colloidal gold particles (1:10 v/v, Cytodiagnostics) and 4 µl of the mixture was applied to a glow-discharged holey-carbon copper EM grid (R2/1 or R2/2 ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Jelena Perovanovic, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Mouse ESCs were cultured as previously described (46) with 2i conditions: ERK inhibitor PD0325901 (1 μM, LC Laboratories) and GSK3 inhibitor CHIR99021 (3 μM ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Susanne Hellmuth, Olaf Stemmann,
bioRxiv - Cell Biology 2024
Quote:
... raised against CAKSKAKPPKGAHVEV = Cys + amino acids 1183-1197 of the human protein) and human anti-CREST (1:1,000; hct-0100, ImmunoVision). Secondary antibodies (all 1:500) ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
Equal amounts of protein (70 μg) supplemented with 5x Protein Loading Buffer (National Diagnostics, USA) were preheated (95°C ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Charneal L. Dixon, et al.,
bioRxiv - Immunology 2023
Quote:
... cDNA was synthesized from 1 µg RNA using SensiFAST cDNA Synthesis Kit (FroggaBio; Concord, Canada). qPCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System in conjunction with a SybrGreen System (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Lynn Sanford, Amy E. Palmer,
bioRxiv - Neuroscience 2020
Quote:
E18 mouse hippocampi were ordered from BrainBits, LLC ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Rahul Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... T7-RILP proteins were expressed in Escherichia coli BL21 (500 μM isopropyl β-d-1-thiogalactopyranoside; Wisent Bioproducts; at room temperature for 16 hours) and purified using standard procedure in tris buffer [20 mM tris (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Ugo Sardo, et al.,
bioRxiv - Physiology 2023
Quote:
Liver proteins were extracted by physical dissociation (Ultra-turrax, IKA) in PEB Buffer (150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Shane Miersch, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Fifty micrograms of protein were injected onto a TSKgel BioAssist G3SWxl (Tosoh) fitted with a guard column using an NGC chromatography system and a C96 autosampler (Biorad) ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 25 ng/mL mouse recombinant (mr) stem cell factor (Gemini bio-products), 25 ng/mL mrFlt3L (Pepro Tech) ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μM 1-NM-PP1 (Toronto Research Chemicals; A603003) was added into one of the cultures to inactivate Cdc2 (Cdk1 ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Yongrong Qiu, et al.,
bioRxiv - Neuroscience 2022
Quote:
We recorded light stimulus-evoked Ca2+ signals in GCL cells of the explanted mouse retina using a MOM-type twophoton (2P) microscope (74, 75) from Sutter Instruments (purchased from Science Products ...