-
No products found
because this supplier's products are not listed.
Jimmy Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... The antibodies used for immunostaining and ELISA were mouse anti-Meth antibody (mouse, 10M25A Fitzgerald), anti-MBD2 (ab45027 ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Sara Ruiz-Rubio, et al.,
bioRxiv - Neuroscience 2023
Quote:
... It indicates the distribution of the expression of the vomeronasal genes from the V1R receptor family (Suárez et al. 2011; Pallé et al. 2020).
-
No products found
because this supplier's products are not listed.
Sounak Chowdhury, et al.,
bioRxiv - Microbiology 2021
Quote:
... Recombinant human IgA-Fc domain (catalog number PR00105) was purchased from Absolute Antibody, UK.
-
No products found
because this supplier's products are not listed.
Jiyun Chen, et al.,
bioRxiv - Biophysics 2023
Quote:
... CjLas1-Grc3 complex and CjLas1 truncated protein (HEPN domain) were first obtained using the sitting drop vapor diffusion method using high-throughput crystallization screening kits (Hampton Research, Molecular Dimensions and QIAGEN). Crystals were then grown in a mixed solution containing 1 μl complex solution and 1 μl of reservoir solution using the hanging drop vapor diffusion method at 16°C ...
-
No products found
because this supplier's products are not listed.
Jeong Yeon Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Asserchrome D-dimer ELISA (#100947) from Stago (Asnières sur Seine, France) and Mouse total fibrinogen (#IMSFFBGKTT) from Innovative Research (Novi, MI) was used to analyse the samples in duplicates.
-
No products found
because this supplier's products are not listed.
Silian Chen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... PBS containing 2 μg/mL Hoechst 33342 and 4 μg/mL pyronin Y (Amresco, cat# 0207) was added to the cells to stain DNA and RNA ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Mary Kay Thompson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Brains were transferred to 1.7 ml epitubes and the media was replaced with BCM containing 500 µM 4-thiouridine (4sU, Carbosynth NT06186) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Marco E. Zamora, et al.,
bioRxiv - Bioengineering 2023
Quote:
... An organic phase containing a mixture of lipids dissolved in ethanol at a designated molar ratio (Fig 1C and Supp Table 1) was mixed with an aqueous phase (50 mM citrate buffer, pH 4) containing Luciferase mRNA (TriLink) at a flow rate ratio of 1:3 and at a total lipid/mRNA weight ratio of 40:1 in a microfluidic mixing device (NanoAssemblr Ignite ...
-
No products found
because this supplier's products are not listed.
Paula Pelayo, et al.,
bioRxiv - Microbiology 2024
Quote:
... Cultures were then normalized to OD=1 and 20 µL was added to a black 96-well plate into containing 350 µM 4-MU-Neu5Ac (Biosynth) dissolved in 80 µL sodium acetate buffer pH 5.5 ...
-
No products found
because this supplier's products are not listed.
Jordan J. Aoyama, Medha Raina, Gisela Storz,
bioRxiv - Microbiology 2021
Quote:
... was separated on denaturing 8% polyacrylamide gels containing 6 M urea (1:4 mix of Ureagel Complete to Ureagel-8 (National Diagnostics) with 0.08% ammonium persulfate ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Slices were superfused with recirculating aCSF (5 mL/min at room temperature) containing 4-methoxy-7-nitroindolinyl-glutamate (MNI-caged-L-Glutamate; HelloBio HB0423) at a concentration of 0.5 mM and used for the whole day of recordings.
-
No products found
because this supplier's products are not listed.
Haijun Xiao, et al.,
bioRxiv - Bioengineering 2024
Quote:
The animals were situated in a chamber where they received ambient air containing 4% isoflurane through an electronic vaporizer (SomnoFlo, Kent Scientific Corporation) for around 5 minutes ...
-
No products found
because this supplier's products are not listed.
Susannah S. Adel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a solution containing AAV9.hsyn viruses encoding either full-length or the extracellular domain of either Sema4D or CD4 (designed and purified by Vector Biolabs) in combination with the same amount of AAV9.hsyn.GFP virus (Addgene ...
-
No products found
because this supplier's products are not listed.
Audry Fernandez, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... intraperitoneally at day 0 and orally via consumption (ad lib) of standard mouse chow containing 200 mg dox per 1 kg food (Bio-Serv). ICB therapy was studied using the InVivoMAbs anti-mouse PD1 (CD279 ...
-
No products found
because this supplier's products are not listed.
Alice Bochel, et al.,
bioRxiv - Biophysics 2023
Quote:
The gene encoding human THSD7A domains d1_d2 (UNIPROT Q9UPZ6, residues A48–Q192) was sub-cloned into the eukaryotic expression vector pDSG-IBA104 (IBA Lifesciences, Göttingen, Germany). It positioned a BM40 secretion signal ...
-
No products found
because this supplier's products are not listed.
Nemailla Bonturi, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... Plasmids containing the assemblies were recovered using Favorprep™ Plasmid DNA Extraction Mini Kit (Favorgen, Wien, Austria). DNA Sanger sequencing was used to confirm parts and constructs.
-
No products found
because this supplier's products are not listed.
Peixiang Zhang, et al.,
bioRxiv - Physiology 2022
Quote:
... mice were maintained on mouse chow (diet D1001 containing 10 kcal% fat, 20 kcal% protein and 70 kcal% carbohydrate; Research Diets, New Brunswick, NJ) or chow containing simvastatin (0.1 g/Kg body weight in mouse chow ...
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... containing FBS (Omega Scientific), L-glutamine and Sodium Pyruvate (Sigma ...
-
No products found
because this supplier's products are not listed.
Joji Tsunada, Steven J. Eliades,
bioRxiv - Neuroscience 2024
Quote:
... The arrays consist of a 4×4 grid of individually moveable electrodes (4 Mohm tungsten, FHC). Neural signals were sampled at 24 kHz and stored for offline analysis (RA16CH ...
-
The 11B11 monoclonal antibody reacts with mouse IL-4 (interleukin-4) which is a multifunctional...
Cat# A2109, SKU# A2109-5mg,
5mg, $279.00
Ask
Vivek K. Bajpai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 10 μM SB431542 (Selleck Chemicals) and 500nM LDN193189 (Selleck Chemicals ...
-
No products found
because this supplier's products are not listed.
Luke A. Simpson, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... in AFA fibre containing vesicles (Covaris). Chromatin shearing was performed under the following conditions ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Georgios Kotsaris, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... containing 10% fetal bovine serum (PAN biotech), 1% Penicillin Steptomycin (P/S ...
-
No products found
because this supplier's products are not listed.
Abubakar Muhammad, et al.,
bioRxiv - Genomics 2024
Quote:
... coated glassbottom dishes containing a microwell (MatTek). Cells were imaged using a Zeiss AxioObserver Z1 confocal spinning disk microscope with an EMM-CCD camera (Photometrics ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Christian Peters, et al.,
bioRxiv - Neuroscience 2022
Quote:
... embedded in 4% agarose (#01280, Biomol) (w/v ...
-
No products found
because this supplier's products are not listed.
Mary Catherine Bridges, et al.,
bioRxiv - Cell Biology 2023
Quote:
... containing 2x amount of protease (cocktail III, RPI) and phosphatase inhibitors (Pierce) ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
No products found
because this supplier's products are not listed.
Hongmei Qiao, et al.,
bioRxiv - Genomics 2020
Quote:
... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
No products found
because this supplier's products are not listed.
Abigail Hui En Chan, et al.,
bioRxiv - Genomics 2022
Quote:
... containing 15 µl of 2X i-TaqTM mastermix (iNtRON Biotechnology, Gyeonggi, South Korea), 10 µM to 50 µM of each primer and template DNA ...
-
No products found
because this supplier's products are not listed.
Edward I. Patterson, et al.,
bioRxiv - Microbiology 2020
Quote:
... and a domain linker ((G4S)4) between the variable heavy (VH) and variable light (VL) domains (Integrative DNA Technologies) (Figure 1B) ...
-
No products found
because this supplier's products are not listed.
Nina Jurčić, et al.,
bioRxiv - Neuroscience 2021
Quote:
... connected to a computer through a frame grabber (CoolSNAP LVDS interface cards, Photometrics) and controlled by MetaView software (Molecular Devices Inc) ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Tatsushi Yokoyama, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the cpRFP domain was synthesized (FragmentGENE, GENEWIZ), and RSET ...
-
No products found
because this supplier's products are not listed.
Jyoti Rao, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... pH 7.4] containing 4% fatty-acid-free BSA (Bioworld, 22070017-1). Cells were treated with DMSO or 10µM Forskolin in KRB-HEPES buffer supplemented with 4% fatty-acid-free BSA for at 37°C ...
-
No products found
because this supplier's products are not listed.
Yukiko Harima, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a 300-μl solution containing 4 mg/ml of Fluorogold (#526-94003; Fluorochrome, LLC) in saline was administered via intraperitoneal injection to visualize the abdominal ganglia ...
-
No products found
because this supplier's products are not listed.
Chi-Hong Wu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... They were then incubated with the dilution buffer (5% goat serum in PBS) containing the following primary antibodies at 4°C overnight: chicken anti-GFP (1:1000, Aves Labs), guinea pig anti-Shank3 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Roberto E. Bruna, et al.,
bioRxiv - Microbiology 2020
Quote:
... to AHA containing proteins was carried out using Click-&-Go™ Protein Reaction Buffer Kit (Click Chemistry Tools) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Virginia Hargest, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads for 4 minutes on speed setting 4 (Next Advance air cooling bullet blender), and pelleted by centrifugation at 12,000 rpm for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Prachiti Moghe, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... containing 10% serum substitute supplement (Irvine Scientific). The COCs were stripped off cumulus cells with 0.5 mg/ml hyaluronidase (Sigma Chemical) ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Eros Di Giorgio, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 4 µM Random hexamers (Euroclone). qRT-PCRs were performed using SYBR green technology (KAPA Biosystems) ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...