-
No products found
because this supplier's products are not listed.
Rebecca Kochanowsky, et al.,
bioRxiv - Microbiology 2022
Quote:
... Anti-Myc antibody (Protein Mods, Madison WI, USA) was used at 1:5,000 and the detecting anti-mouse antibody (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
Recombinant Antigen
Cat# REC31603-100,
100µg USD $496.0
Ask
Mathieu Ferrari, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were washed with 0.05% v/v PBS-Tween and sequentially incubated with mouse anti-SARS-CoV-2 N protein antibody (The Native Antigen Company – MAB12183-100) at 1:500 dilution and HRP-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch – 115-035-146 ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Maryna Kapustina, et al.,
bioRxiv - Cell Biology 2022
Quote:
... N=0 from Mattek or CellVic companies ...
-
No products found
because this supplier's products are not listed.
Ansgar Flammersfeld, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-(p-amylcinnamoyl) anthranilic acid (Biomol), and bromoenol lactone (Biomol) ...
-
No products found
because this supplier's products are not listed.
Taru Hilander, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1% N-Dodecyl-b-D-Maltoside (Amresco, J424,), 1% Phenylmethanesulfonyl fluoride (PMSF ...
-
No products found
because this supplier's products are not listed.
Mariangela Scarduzio, et al.,
bioRxiv - Neuroscience 2024
Quote:
PNKD-Tg mice (N= 9) and their WT littermates (N= 7) were implanted with a microdialysis probe cannula (CMA7/2 mm, Harvard Apparatus) above the dorsal striatum ...
-
No products found
because this supplier's products are not listed.
Megan E. Goeckel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
The embryos were lysed and purified with DNA/RNA/Protein extraction kit (#IB47702, IBI Scientific) and then cDNA generated with SuperScript™ IV VILO™ Master Mix (#11766050 ...
-
No products found
because this supplier's products are not listed.
Henrik Schinke, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Kyse30 and FaDu cells were stably transfected with SLUG-Myc in the 141-pCAG-3SIP vector with MATra transfection reagent (PromoCell) using 1 μg/ mL puromycin (Sigma ...
-
No products found
because this supplier's products are not listed.
Ming Bi, et al.,
bioRxiv - Systems Biology 2023
Quote:
Permethylated N-glycans were trapped on a C18 (5 μm, 300 Å, Jupiter, Phenomenex) trap column and separated on a C18 analytical column (75 μid ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Grant Ashby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Texas Red-DHPE (1,2-dihexadecanoly-snglvero-3-phosphoethanolamine-[N-(Texas Red sulfonyl)]) was purchased from AAT Bioquest. PEG-biotin (Biotin-PEG SVA ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Katarzyna Bogucka-Janczi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or ERK3 protein (M31-34G, SignalChem). ARP2/3 protein complex ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Lien D. Nguyen, et al.,
bioRxiv - Neuroscience 2022
Quote:
Total protein was extracted using RIPA buffer (Boston Bioproducts) supplemented with Complete ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Sirisha Thippabhotla, Cuncong Zhong, Mei He,
bioRxiv - Bioengineering 2019
Quote:
The RNA library was prepared by using the commercial library preparation kit NEXTflex small RNA sequencing kit (Bioo Scientific, NOVA-5132-05) following the recommended protocol by the manufactures ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Myc 1:200 (Alfagene/Life Technologies #13-2500). The secondary antibodies (1:600 dilution ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
Anti-Myc magnetic beads kit is based on hydroxyl magnetic beads covalently coupling with mouse...
Cat# B26302, SKU# B26302-5 mL,
5 mL, $999.00
Ask
Yun-Ruei Kao, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 µM c-Myc inhibitor (10058-F4, Selleck Chemicals).
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... amino acids (5 eq) were activated with N,N′-diisopropylcarbodiimide (DIC, 5 eq, Oakwood Chemical)/Oxyma (5 eq ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Christopher M. Yellman,
bioRxiv - Genetics 2021
Quote:
... The native Nop1 protein was stained with the MCA-28F2 mouse monoclonal antibody (EnCor Biotechnology), followed by anti-mouse CY3 (Jackson ImmunoResearch)
-
No products found
because this supplier's products are not listed.
Sehyun Kim, et al.,
bioRxiv - Genetics 2022
Quote:
... hfRPE cells were treated with 20μM A2E (N-Retinylidene-N-Retinylethanolamine, 20mM stock dissolved in DMSO, Gene and Cell Technologies) for 24 hours.
-
No products found
because this supplier's products are not listed.
Matthew J. Stevenson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
DNA sequences flanked by XhoI and NdeI restriction sites and encoding for N-terminal GST-tagged-SIX1 or N-terminal GST-tagged-SIX1-Q177R homeodomains were synthesized by Integrative DNA Technologies (IDT) as gBlocks (Supplemental Table 2) ...
-
No products found
because this supplier's products are not listed.
Aditya N. Bade, et al.,
bioRxiv - Bioengineering 2021
Quote:
CEST imaging was performed on controls (n = 8) and 3TC-treated mice (n = 7) on a 7 Tesla MRI scanner (Bruker BioSpec 70/20, Billerica, MA). A Bruker-made volume quadrature RF coil was employed for signal transmission and a Bruker 4-element coil array was used for signal reception ...
-
No products found
Michael P. Vincent, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Fmoc-N-amido-dPEG24-amido-dPEG24-acid (Quanta Biodesign) were purchased for use in the synthesis of the PG6 ...
-
No products found
because this supplier's products are not listed.
Samuel Lim, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... turbonuclease (Accelagen) and 1% n-Nonyl-Beta-D-Glucopyranoside (Cube Biotech) and shaken vigorously for 1 hour ...
-
No products found
because this supplier's products are not listed.
Mirjam C van der Net, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was recloned in a pDONR221 backbone and the Myc-tag was replaced with a Flag-tag (Epoch Life Science). The sequence 5’-CAATGCGGAATATCAATCCCAGCACAGCAAATTCTCCA AAATGTCAGG-3’ was added between base pairs 982 and 983 of the YAP1 gene ...
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti Cav2.3 N-terminus 1:250 (Covalab, custom 1, HEK293 & brain), rabbit anti pS15 Cav2.3 1:500 (Covalab ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant proteins were passively absorbed onto streptavidin functionalized 4-µm fluorescent microparticles (Carboxy Blue Particle Array Kit, Spherotech). 500 µg of biotinylated recombinant protein was incubated with 2 x 107 streptavidin functionalized fluorescent microparticles in 400 µL of 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Zoila A. Lopez-Bujanda, et al.,
bioRxiv - Immunology 2019
Quote:
... Knock out clones were screened for IL-8 and Cxcl15 expression by ELISA and gene-editing confirmed by PCR amplification and Sanger sequencing (GENEWIZ) using primers ∼200bp away from the cut site (IL-8 Forward ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Emmanuela Adjei-Sowah, et al.,
bioRxiv - Bioengineering 2023
Quote:
... GPC measurements were performed on a Shimadzu 20A GPC system equipped with a TSKgel SuperHM-N and complementary guard columns from Tosoh Bioscience ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...