-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Daniela Fraccarollo, et al.,
bioRxiv - Immunology 2021
Quote:
... Serum samples were screened for CMV-specific IgG antibodies with the CMV-IgG-ELISA PKS Medac enzyme immunoassay (115-Q-PKS; Medac Diagnostika), using a cut-off value of >0.55 AU/mL for defining seropositivity according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Timothy A Fenton, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Species-specific fluorophores-conjugated IgG (1:500; Thomas Scientific) was used as secondary antibodies (45 minutes ...
-
No products found
because this supplier's products are not listed.
Trisha M. Zintel, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... neurons for neuron-specific class III β-tubulin (TUJ1; Neuromics, Edina, MN), and astrocytes for GFAP (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Benjamin H Gern, et al.,
bioRxiv - Immunology 2019
Quote:
... Antibody detection was performed using species specific polymer HRP-conjugated systems (GBI Labs) coupled with tyramide signal amplification (TSA ...
-
No products found
because this supplier's products are not listed.
Christopher R. Main, et al.,
bioRxiv - Microbiology 2020
Quote:
... and specific conductivity were measured using a YSI 650 (YSI Inc., Yellow Springs, OH). Dissolved nutrients (NO3 plus NO2 [NOX] ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
S protein (Cube Biotech #28703) and isolated platelets were mixed at final concentrations of 0.2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Christopher R. Brown, James D. Foster,
bioRxiv - Neuroscience 2024
Quote:
... NET expression levels were verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting of the cellular lysates against anti-human NET specific antibody (NET17-1 – MAb Technologies).
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Jianbo Dai, et al.,
bioRxiv - Microbiology 2020
Quote:
... The caspase activities of the supernatant against substrates for caspase 8 were determined using a fluorescent assay based on the cleavage of a AMC (7-amino-4-methylcoumarin) dye from the C-terminal of specific peptide substrates (Caspase Fluorescent (AMC) Substrate/Inhibitor QuantiPak™) (BioMol International).
-
No products found
because this supplier's products are not listed.
Hélène Scheer, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10 pmol of gene-specific primer (Supplementary Table 7) and 10 pmol of a TruSeq RNA PCR index (RPI, Supplementary Table 7) 10 nmol of dNTP ...
-
No products found
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... or mouse anti-VP5 (Biodesign. International) 1:500 ...
-
No products found
because this supplier's products are not listed.
Kristine L Trotta, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was transferred to nitrocellulose (0.2µm; GVS) via semi-dry transfer with a TransBlot Turbo transfer system (BioRad ...
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Mingyu Fang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... gels were either stained with Coomassie (Protein Ark) or transferred to PVDF membranes for Western blot analysis.
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Cristina Márquez-López, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Nsp1 proteins were performed in 35-mm tissue culture dishes (MatTek) using the jetPRIME® reagent according to the manufacturer’s protocol (Polyplus transfection®) ...
-
No products found
because this supplier's products are not listed.
Michael Korenkov, et al.,
bioRxiv - Immunology 2023
Quote:
For protein complexes crystallization we used a mosquito crystallization robot (TTP Labtech) to set vapor diffusion sitting drops with 96-well iQ plates (TTP Labtech) ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Sadis Matalon, et al.,
bioRxiv - Physiology 2023
Quote:
... The 8.1kb mtDNA was amplified by PCR and quantitatively analyzed by real-time PCR using specific primers provided in the Mouse Real-Time PCR Mitochondrial DNA Damage Analysis Kit from Detroit R&D (cat. #DD2M; Detroit, MI). Mitochondrial damage in the 8.1kb mtDNA fragment was quantified by a standard curve prepared ...
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Livia Mazzini, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 1µg/mL of purified recombinant Spike S1 Protein (aa 18-676) (eEnzyme, Gaithersburg, MD, USA) or with 1µg/mL Spike-RBD (Arg319-Phe541 ...
-
No products found
because this supplier's products are not listed.
Sung-Eun Choi, et al.,
bioRxiv - Pathology 2020
Quote:
... Total protein in the hydrolysed sample was also measured using the Total Protein Assay Kit (QuickZyme) and the relative amount of collagen per protein was analysed.
-
No products found
because this supplier's products are not listed.
Jessica Kain, et al.,
bioRxiv - Genetics 2020
Quote:
... Foxa2-specific rabbit antiserum (Seven Hills Bioreagents, WRAB-1,200) and rabbit polyclonal antibody specific to LXRα (Active Motif ...
-
No products found
because this supplier's products are not listed.
Ankita M. George, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse monoclonal antibody targeting the nucleocapsid protein of CDV (CDV-NP, VMRD, WA, USA) was used at a dilution of 1:2000 (60 min incubation) ...
-
No products found
because this supplier's products are not listed.
AR Caseiro, et al.,
bioRxiv - Bioengineering 2019
Quote:
... and expanded using specific expansion medium (211-500, Cell Applications, Inc). Cells were maintained at 37°C and 95% humidified atmosphere with 5% CO2 environment ...
-
No products found
because this supplier's products are not listed.
Sabarish Ramachandran, et al.,
bioRxiv - Cancer Biology 2021
Quote:
[2,3-3H]-L-Serine (specific radioactivity, >5 Ci/mmol) was purchased from Moravek, Inc ...
-
No products found
because this supplier's products are not listed.
Scott M. Reba, et al.,
bioRxiv - Immunology 2021
Quote:
... Mice were housed under specific-pathogen-free conditions in ventilated microisolator cages (Lab Products, Inc., Maywood, NJ). The Institutional Animal Care and Use Committee at Case Western Reserve University approved all studies.
-
No products found
because this supplier's products are not listed.
Beiyuan Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... in which guide RNA contains crRNA with specific DNA target sequence and tracrRNA labeled with ATTO™ 550 (ATTO-TEC). Two crRNAs targeting SIX4 (ACAACTCCACTCGGAACTTC and CCTCGCACACGCAGGCGACA ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
Equal amounts of protein (70 μg) supplemented with 5x Protein Loading Buffer (National Diagnostics, USA) were preheated (95°C ...
-
No products found
because this supplier's products are not listed.
Yi-Nan Zhang, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant mouse Flt3 ligand (Flt3L) and mouse SCF were purchased from Shenandoah Biotech (Warwick, PA). Cells were stained with appropriate concentrations of mAbs ...
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Marco De Giorgi, et al.,
bioRxiv - Genetics 2023
Quote:
Primary mouse hepatocytes were purchased from BioIVT and cultured in INVITROGRO medium with 10% of fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Reza Nouri, et al.,
bioRxiv - Bioengineering 2022
Quote:
... LwaCas13a proteins were purchased from MCLAB (cat# CAS13a-100). Cas13a and crRNA were mixed in 1×PBS to form the non-activated Cas13a/crRNA at room temperature for 20 min and stored at -80°C ...
-
No products found
because this supplier's products are not listed.
Joanne F. Garbincius, et al.,
bioRxiv - Physiology 2023
Quote:
... Protein concentration was determined by bicinchoninic acid assay (BioWORLD #20831001). 2500µg of cleared mitochondrial lysate were fractionated by gel filtration using fast protein size-exclusion liquid chromatography (AKTA Pure FPLC ...
-
No products found
because this supplier's products are not listed.
Grant A. King, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein extracts were generated by pulverization using a Mini-Beadbeater-96 (BioSpec). The samples were then treated with 50 µl of 3X SDS sample buffer (187.5 mM Tris pH 6.8 ...
-
No products found
because this supplier's products are not listed.
Arthur Forer, Shotaro Otsuka,
bioRxiv - Cell Biology 2023
Quote:
Gold beads (15 nm) conjugated with Protein A (Cytodiagnostics, Burlington, Ontario, Canada) were absorbed on both sides of the sections as fiducial markers for tomography reconstruction ...
-
No products found
because this supplier's products are not listed.
Seraina A. Domenig, et al.,
bioRxiv - Cell Biology 2023
Quote:
... at 37°C using DirectPCR Lysis Reagent (mouse tail) (VIG102-T, Viagen Biotech). PCR for Pax7-nGFP was performed using primer Pax7nGFP.F/ Pax7nGFP.R and GoTaq G2 Hot Start Green Master Mix (M7423 ...
-
No products found
because this supplier's products are not listed.
Matthew Patrick, et al.,
bioRxiv - Bioengineering 2023
Quote:
... or a Picro-Sirius Red staining kit (StatLab), following the respective manufacturer’s instructions or immunohistochemistry (IHC ...