-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Qian Shi, et al.,
bioRxiv - Physiology 2022
Quote:
... anti-β2-adrenergic receptor (β2AR) (A-B2AR, Badrilla), anti-β1-adrenergic receptor (β1AR ...
-
No products found
because this supplier's products are not listed.
Nicholas J Swanson, et al.,
bioRxiv - Microbiology 2023
Quote:
... Lyophilized Receptor Destroying Enzyme II (RDE, Hardy Diagnostics) was dissolved into 20 mL of saline (0.9% NaCl in H2O ...
-
No products found
because this supplier's products are not listed.
Hanshuang Shao, Diana Teramae, Alan Wells,
bioRxiv - Cell Biology 2022
Quote:
... Melanocytes were grown in DermaLife M media in the presence of growth factors and chemical components (Lifeline Cell Technology, Frederick, MD).
-
No products found
because this supplier's products are not listed.
Michael J. Robertson, et al.,
bioRxiv - Biophysics 2022
Quote:
All receptors were expressed in Sf9 insect cells (Expression Systems) infected at a density of 3-4 million cells/ml ...
-
No products found
because this supplier's products are not listed.
Susanne N. Walker, et al.,
bioRxiv - Immunology 2020
Quote:
... Followed by capture of SARS-CoV-2 receptor binding domain which was biotinylated using the lightning-link type-A biotinylation kit(Expedeon/Abcam, 370-0005) for 180s at 10ul/min ...
-
No products found
because this supplier's products are not listed.
Suzanne O Nolan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... was first utilized to assess gross anatomical features and place the stimulating electrode before switching to a 16x water dipping objective (16X Nikon CFI LWD Plan Fluorite Objective ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Rory Henderson, et al.,
bioRxiv - Immunology 2023
Quote:
... The synthetic Toll-like receptor 7/8 agonist 3M-052 absorbed to ALUM (3M-052-ALUM) was used as the adjuvant for the vaccine immunogens ...
-
No products found
because this supplier's products are not listed.
Agnès Roure, Rafath Chowdhury, Sébastien Darras,
bioRxiv - Developmental Biology 2022
Quote:
... or 2.5 μM of the BMP receptor inhibitor DMH1 (S7146, Euromedex, 10 mM stock solution in DMSO) at the stages indicated in the text and figures ...
-
No products found
because this supplier's products are not listed.
Thusitha K. Karunarathna, et al.,
bioRxiv - Microbiology 2023
Quote:
Binding of virus and sialic receptor analogous was measured using an Octet Red biolayer interferometer (Pall FortéBio) as previously described (37) ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Krishna K. Narayanan, et al.,
bioRxiv - Microbiology 2023
Quote:
... The eluted proteins were concentrated with a centrifugal device (MWCO 30 kDa for soluble EFNB2 proteins and 50 kDa for soluble Eph receptor proteins; Sartorius) before being separated on a Superdex 200 Increase 10/300 GL (Cytiva Life Sciences ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Eleanor M Denham, et al.,
bioRxiv - Immunology 2019
Quote:
Cells were analysed for receptor surface expression by flow cytometry using anti-Strep-tag II antibody Oyster 645 (IBA Lifesciences # 2-1555-050), or anti-Strep-tag II antibody (IBA Lifesciences # 2-1507-001 ...
-
No products found
because this supplier's products are not listed.
Angela M. Bosco-Lauth, et al.,
bioRxiv - Microbiology 2020
Quote:
... Positive control antibodies to the receptor-binding domain (RBD) and full-length spike protein were human MAb CR3022 antibody (Absolute Antibody, Oxford UK) and human IgG whole molecule (Jackson Immuno Research ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Lola Holcomb, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse serum samples were diluted 10-fold using the kit-specific reagent (SPCKA-MP-007374, Protein Simple, Bio-Techne), and the concentrations were measured following the manufacturer’s instructions on the Ella system ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
Cat# AK290-2,
USD $495.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Marta Perera, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse ESCs were cultured in 8-wells slides (Ibidi). ESC immunostaining was carried out as previously described in Canham et al. ...
-
No products found
because this supplier's products are not listed.
Thomas Dal Maso, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mouse genotyping was performed with WONDER Taq Hot START (Euroclone) using the following primers ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and Click-&-Go Cell Reaction Buffer Kit (Click Chemistry Tools), and 3 ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...