-
No products found
because this supplier's products are not listed.
Dhaarsini Jaksch, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Cells expressing the shRNA constructs were selected using 1 mg/mL Neomycin (Calbiochem, #480100). To induce expression of shRNAs cells were treated for 3 days with 2 µg/mL Dox.
-
No products found
because this supplier's products are not listed.
Veena Padmanaban, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Libraries were constructed from 500 ng of total RNAs isolated from 4T1 (scrambled vs Tlr7 shRNA) using the TruSeq RNA Library Prep Kit (Illumina). Constructed libraries were sequenced using Illumina NextSeq (High Output ...
-
No products found
because this supplier's products are not listed.
Abir Mukherjee, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 million stable SKOV3ip1 cells (transduced with either control shRNA or shRNA targeting HIF1α) were injected into female athymic nude mice (Envigo), and tumors were allowed to establish for 4 weeks ...
-
No products found
because this supplier's products are not listed.
David V.C. Brito, et al.,
bioRxiv - Neuroscience 2020
Quote:
... we used adult male C57BL/6N mice that were 8 weeks old at the time of surgery [(MeCP2-shRNA (n=8) or Control-shRNA (n=8)] (Charles River, Sulzfeld, Germany). The mice were group-housed on a 12h light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Emily Hansen, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cells expressing the various shRNAs were selected with 0.2 mg/ml hygromycin (cat#K547-20ml, VWR) at 72-hours post transfection and maintained at 0.8 mg/ml of hygromycin after cell line purification.
-
No products found
because this supplier's products are not listed.
Maria V. Sinegubova, et al.,
bioRxiv - Biochemistry 2020
Quote:
... plasmid # 162785 Plasmids for cell transfections were purified by the Plasmid Midiprep kit (Evrogen, Moscow, Russia) and concentrated by ethanol precipitation in sterile conditions.
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Mouse TrueBlot ULTRA (anti-Mouse Ig (Rockland) secondary antibody ...
-
No products found
because this supplier's products are not listed.
Arja Ray, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1:200 rat anti-mouse CD31 (Dianova, Mouse), 1:400 rabbit anti-CD31/PECAM-1 (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Danielle N. Gallagher, et al.,
bioRxiv - Genetics 2020
Quote:
... Plasmids were verfieid by sequencing (GENEWIZ) and transformed as previously described80.
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse Gephyrin (1:1000, Synaptic Systems, catalog #147021), Neuroligin-1 (1:300 ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CENP-A (mouse mAb, AbCam, ab13939; mouse mAb, GeneTex, GTX13939), CENP-C (guinea pig pAb ...
-
No products found
because this supplier's products are not listed.
Alejandro Prieto, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse IgA (Bethyl) was used as a standard for the determination of total IgA ...
-
No products found
because this supplier's products are not listed.
Iulia Rusu, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant mouse IL-1β and mouse LIGHT were purchased from Peprotech. Pam3CSK4 ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... mouse anti-KCNMA1 (Abnova), mouse monoclonal anti-Na+/K+-ATPase β1 subunit (Sigma ...
-
No products found
because this supplier's products are not listed.
Maitreyi Rathod, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse DSG1 ((#651111 Progen), rabbit keratin 10 (#905403 Biolegend) ...
-
No products found
because this supplier's products are not listed.
V Paradise, et al.,
bioRxiv - Neuroscience 2022
Quote:
Stable RAP expression plasmid was obtained from Kerafast (EMD008) and was transformed into T7 Express lysY Competent E ...
-
No products found
because this supplier's products are not listed.
Liqiao Hu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Plasmids were transfected using the HighGene Transfection Reagent (ABclonal). HeLa cells were transfected using Lipofectamine 2000 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Zhicong Chen, et al.,
bioRxiv - Cancer Biology 2022
Quote:
LIPA shRNA lentivirus was purchased from GenTarget Inc (USA) ...
-
No products found
because this supplier's products are not listed.
Yun-Fei Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Approximately 30 mycn mutant or WT zebrafish embryos at 3 dpf were transferred to 1.5mL Low binding microcentrifuge tubes (Eppendorf 022431021). Trypsin-EDTA solution (Beyotime ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... HUVECs expressing the shRNAs were plated in μ-Slide VI 0.4 (80606; IBIDI) at a density of 30,000cells per channel in starving medium (EBM+0.5%serum+doxy+puro) ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, Darren Diaz, Jarrod J. Mousa,
bioRxiv - Immunology 2020
Quote:
... Plasmids were purified using the EZNA plasmid maxi kit (Omega BioTek), according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Benjamin H. Weinberg, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... plasmid DNA was isolated using mini plasmid preparation (Epoch Life Science). Analytical digests with MluI/BspEI were performed and run on gel electrophoresis to assay if a correct product was made ...
-
No products found
because this supplier's products are not listed.
C López-Haber, et al.,
bioRxiv - Cell Biology 2020
Quote:
Recombinant lentiviruses encoding shRNAs were produced by co-transfection of 293T cells (obtained from American Type Culture Collection, Mannassas, VA) with packaging vectors pDM2.G and pSPAx2 using calcium phosphate precipitation (Marks et al ...
-
No products found
because this supplier's products are not listed.
Wiktoria Ogrodzińska, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The recombinant plasmids were isolated using plasmid purification kit (Bio Basic Canada) and the inserts were verified by sequencing (Genomed ...
-
No products found
because this supplier's products are not listed.
Coraline Mercier, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasmid extraction was performed with ISOLATE II Plasmid Mini Kit (Bioline, London, UK) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicolas Tricaud, et al.,
bioRxiv - Neuroscience 2019
Quote:
... the U6-VDAC1-shRNA sequences were then cut using ApaI and BstEI to be cloned into a pAAV-CMV-GFP vector (Cell Biolabs, Inc.), the pAAV-mito-GCaMP2 ...
-
No products found
because this supplier's products are not listed.
Marco Thürkauf, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... plasmid using PEI MAX (Polyscience). For small or large AAV preparations ...
-
No products found
because this supplier's products are not listed.
Brandon Cieniewicz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... the lentiviral plasmid was combined with three packaging plasmids encoding VSV-G (Aldevron, Cat# 5037-5), gag/pol (Aldevron ...
-
No products found
because this supplier's products are not listed.
Juanita C. Limas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Plasmids were validated via sequencing (Eton Biosciences) for the desired insert using appropriate primers.
-
No products found
because this supplier's products are not listed.
Théo Juncker, et al.,
bioRxiv - Immunology 2023
Quote:
... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
No products found
because this supplier's products are not listed.
Tara A. Gleeson, et al.,
bioRxiv - Immunology 2024
Quote:
... mouse-anti-mouse NLRP3 (1/1000 dilution; Cryo2, Adipogen, AG-20B-0014), rabbit-anti-mouse gasdermin-D (1/1000 dilution ...
-
No products found
because this supplier's products are not listed.
Sanduni I. Fernando, et al.,
bioRxiv - Biophysics 2023
Quote:
... anti-mouse CF568 (Biotium), and Phalloidin-Alexa Fluor 488 (Thermo-Fisher ...
-
No products found
because this supplier's products are not listed.
Mitsugu Shimobayashi, et al.,
bioRxiv - Physiology 2020
Quote:
Plasma Leptin levels were measured by mouse mouse Leptin ELISA kit (Crystal Chem) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Charles C. Reed, et al.,
bioRxiv - Immunology 2021
Quote:
... (MabTech, Mouse IFNγ ELISpot Plus). Cells were washed off ...
-
No products found
because this supplier's products are not listed.
Federico Miozzo, et al.,
bioRxiv - Neuroscience 2021
Quote:
... mouse anti-TH (Immunostar 22941) 1:300 ...
-
No products found
because this supplier's products are not listed.
Nuno Apóstolo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mice were placed in a mouse stereotact (KOPF) equipped with a neonatal mouse adaptor (Stoelting). During the rest of the procedure 2.5% isoflurane was constantly administered ...
-
No products found
because this supplier's products are not listed.
Josephine Bock, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse monoclonal anti-Bap31 (Alexis Biochemicals), rabbit polyclonal anti-Synoviolin (Bethyl laboratories Inc.) ...
-
No products found
because this supplier's products are not listed.
Teresa L. Mastracci, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-CD4 (Leica; 1:500). Secondary antibodies including Alexa-488 ...
-
No products found
because this supplier's products are not listed.
Ryan J. Duchatel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Mouse C-peptide ELISA (ALPCO), was then used to quantify C-peptide levels in the plasma ...
-
No products found
because this supplier's products are not listed.
Sofia Zanotti, et al.,
bioRxiv - Cancer Biology 2021
Quote:
RPE1–MYCN-ER cells were grown in black 96-well µClear plates (# 655090, Greiner Bio-One) and fixed with 4% paraformaldehyde for 20 minutes at room temperature followed by washing (3x ...
-
No products found
because this supplier's products are not listed.
Vukasin M. Jovanovic, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse astrocytes (ScienCell) and hPSCs were plated onto Geltrex coated 96 well plates (Corning ...
-
No products found
because this supplier's products are not listed.
Lipsa Panda, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse RXRγ (MyBioSource), Human RXRγ ...
-
No products found
because this supplier's products are not listed.
Bre-Anne Fifield, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... which were diluted with Mouse on Mouse (MOM) blocker (Biocare Medical). Primary antibodies used were as follows ...
-
No products found
because this supplier's products are not listed.
Andrew W. DeVilbiss, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse Ter119 (APC, Tonbo Biosciences) and human HLA-A ...
-
No products found
because this supplier's products are not listed.
Julie Chang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Rac1 (Cytoskeleton.com; ARC03; mouse monoclonal), Cdc42 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Hitoshi Watanabe, et al.,
bioRxiv - Physiology 2022
Quote:
... insulin with a Mouse (Mercodia,) or Human Insulin ELISA kit (both from Mercodia ...
-
No products found
because this supplier's products are not listed.
Nishit Goradia, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... mouse IgG (Diagenode, C15400001, Belgium) or rabbit IgG (Diagenode ...
-
No products found
because this supplier's products are not listed.
Hadjara Sidibé, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-Actin (69100; MP Biomedicals), and mouse anti-G3BP1 (sc-81940 ...
-
No products found
because this supplier's products are not listed.
Quynh T. Phan, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse liver endothelial cells (Cell Biologics), and hTert-immortalized human microvascular endothelial cells (American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Shusei Yoshida, et al.,
bioRxiv - Cell Biology 2024
Quote:
... mouse anti-α-Tubulin (Cedarlane, CLT9002), and rabbit monoclonal anti-UbK48 (Millipore ...