-
No products found
because this supplier's products are not listed.
Hayley R. Waterman, et al.,
bioRxiv - Immunology 2023
Quote:
... high binding ELISA plates (Costar) were coated Sm/RNPs (Arotec Diagnostics ATR01) by adding 50 μl Sm/RNPs (0.5-1 μg/mL ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Shai Sabbah, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti-Rbpms (1:1000, RNA-binding protein with multiple splicing; 1832-Rbpms, PhosphoSolutions), a pan-ganglion-cell marker ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Amanda M. Robinson, et al.,
bioRxiv - Immunology 2021
Quote:
... 100uL of beads were used per library with pure bead binding buffer for the remaining volume (Bead Binding Buffer, 2.5M NaCl, 20% vol/vol PEG, Teknova #P4146). The beads and library were mixed and allowed to bind for 5 minutes at room temperature before using a magnetic stand to pellet the beads for removal of supernatant ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Evan Lester, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... non-specific binding sites were blocked using Super Block (Scytek), supplemented with Avidin (Vector Labs) ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
Laura Medina-Puche, et al.,
bioRxiv - Plant Biology 2019
Quote:
... GFP-fused proteins were detected using mouse monoclonal anti-GFP antibody (1:5,000; Abiocode).
-
No products found
because this supplier's products are not listed.
Christopher M. Yellman,
bioRxiv - Genetics 2021
Quote:
... The native Nop1 protein was stained with the MCA-28F2 mouse monoclonal antibody (EnCor Biotechnology), followed by anti-mouse CY3 (Jackson ImmunoResearch)
-
No products found
because this supplier's products are not listed.
Yu-Le Wu, et al.,
bioRxiv - Biophysics 2021
Quote:
... Binding of primary antibody (Elys (catalog no. HPA031658, Atlas Antibodies, 1:50), Nup133 (catalog no ...
-
No products found
because this supplier's products are not listed.
Eric M. Patrick, et al.,
bioRxiv - Biochemistry 2019
Quote:
... prior to binding of the complex to 1 μM diameter polystyrene beads (Spherotech) functionalized with an anti-digoxigenin antibody (Roche ...
-
No products found
because this supplier's products are not listed.
Ann McCartney, et al.,
bioRxiv - Genomics 2020
Quote:
... according to the manufacturer’s protocol but using150 μL Bead Binding buffer (Phase Genomics) for coupling the biotinylated molecules to the beads and continue with the Phase Genomics Hi-C kit for plants protocol ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
L. Perrin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... SIDs were made by binding poly-dimethyl-siloxane (PDMS) disks to the glass-bottom dishes (MatTek Corporation). Each PDMS disk measures 17.5 mm in diameter and contains three wells ...
-
No products found
because this supplier's products are not listed.
Krishna Patel, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Conversion of dsDNAs to ssDNAs was determined by their binding to SSB (MCLAB - Molecular Cloning Laboratories, CA). DNA samples were mixed with 1 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Suehelay Acevedo-Acevedo, et al.,
bioRxiv - Physiology 2022
Quote:
LKB1 fl/fl were injected with adeno-associated virus 8 (AAV8; 1.25 × 1011 GC) expressing Cre recombinase under the hepatocyte thyroid hormone-binding globulin (TBG) promoter (Vector Biolabs). AAV8 was delivered by tail vein injection to LKB1 fl/fl and C57BL/6J at 6 weeks of age and mice were analyzed 4 weeks after ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Christopher Cyrus Kuhn, et al.,
bioRxiv - Cell Biology 2022
Quote:
S protein (Cube Biotech #28703) and isolated platelets were mixed at final concentrations of 0.2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Taylor E. Murphy, et al.,
bioRxiv - Physiology 2023
Quote:
... Reactions were cleared of non-specific binding by incubating with 25 µl of PrecipHen reagent (agarose-coupled goat anti-chicken IgY; Aves Lab; Davis, CA, USA) for 30 min with gentle rocking ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Alexander W. Justin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Green fluorescent protein (GFP) and Red Fluorescent Protein (RFP) human umbilical vein endothelial cells (HUVECs, Promocell), normal human lung fibroblasts (NHLFs ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and anti-mouse (for HA; Covalab) were used as secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Hunter C. Davis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse was kept on a heating pad (WPI ATC2000) to maintain stable body temperature at 37 °C and its eyes were kept moist using ophthalmic eye ointment ...
-
No products found
because this supplier's products are not listed.
Kyoko Chiba, et al.,
bioRxiv - Biophysics 2021
Quote:
The purified proteins were analyzed using BioSep SEC-s4000 (Phenomenex) particle size 5 μm ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Robert R. Bowers, et al.,
bioRxiv - Genetics 2021
Quote:
... coli kit (MS-CRED-KIT) was purchased from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Shane Miersch, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Fifty micrograms of protein were injected onto a TSKgel BioAssist G3SWxl (Tosoh) fitted with a guard column using an NGC chromatography system and a C96 autosampler (Biorad) ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... All clones were initially identified as ACPAs by screening using antigen microarray binding to citrullinated peptides and CCP2 by CCPlus ELISA (Svar Life Science) at 5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
Toby Buttress, et al.,
bioRxiv - Plant Biology 2021
Quote:
... In vitro experiments were recorded on 384 low-binding multi-well 0.17 mm microscopy plates (In Vitro Scientific) and sealed with optically clear adhesive film ...
-
No products found
because this supplier's products are not listed.
Xiao Han, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 grams of yeast powder was dissolved in 30 mL binding buffer with 50 µL protease inhibitor cocktail IV (BioWorld), and 300 µL of 100 mM PMSF ...
-
No products found
because this supplier's products are not listed.
Magdalena Malm, et al.,
bioRxiv - Systems Biology 2021
Quote:
... The expression of THBS4 in each sample was evaluated by sandwich ELISA using a human anti-HPC4-antibody (Icosagen) as capture antibody ...
-
No products found
because this supplier's products are not listed.
Kristine L Trotta, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was transferred to nitrocellulose (0.2µm; GVS) via semi-dry transfer with a TransBlot Turbo transfer system (BioRad ...
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PVDF membrane was cut at 75 kDa according to protein ladder (BlueElf, FroggaBio). The higher molecular weight portion of the membrane was incubated with ATP7B antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).