-
No products found
because this supplier's products are not listed.
Kimberley El, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Phosphorylated EGFRY1068 (Cell Signaling, #3777, 1:1000 with Nacalai USA Signal Enhancer HIKARI) levels were normalized to total protein levels (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Jing Zeng, et al.,
bioRxiv - Genetics 2023
Quote:
... 100 ng ml-1 Preclinical Stem Cell Growth Factor (SCF) (CellGenix, cat# 1418- 050) and 100 ng ml-1 Preclinical FMS-like Tyrosine Kinase 3 Ligand (FLT3L ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... binding on silica columns (IBI scientific, IB47207) with 4 volumes of guanidine thiocyanate (4.125 M guanidine thiocyanate ...
-
No products found
because this supplier's products are not listed.
Junyu Chen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Low binding silica beads (400 μm, Ops Diagnostics, Lebanon NJ) were added to each sample and vortexed at high speed ...
-
No products found
because this supplier's products are not listed.
Susanne N. Walker, et al.,
bioRxiv - Immunology 2020
Quote:
... Followed by capture of SARS-CoV-2 receptor binding domain which was biotinylated using the lightning-link type-A biotinylation kit(Expedeon/Abcam, 370-0005) for 180s at 10ul/min ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Briana N Markham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-GAPDH (Meridian Life Sciences, H86504M, 1:750,000), mouse IgG2b anti-PINK1 (Novus ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Eri Morimoto, Kotaro Tsuboyama, Yukihide Tomari,
bioRxiv - Biochemistry 2022
Quote:
... Anti-mouse antibody was used as the secondary antibody at 1:100 (Protein Simple).
-
No products found
because this supplier's products are not listed.
Giorgia Fedele, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5 U/mL Heparin and 150 μg/mL Endothelial Cell Growth Factor on 2% gelatin-coated dishes (Euroclone). Human astrocytes (HA ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Christian Stocker, et al.,
bioRxiv - Biochemistry 2023
Quote:
... *JbCDTCM crystals were obtained at 20 °C from a 1:1 (200 nL:200 nL) mixture of protein sample and solution C1 from the Morpheus crystallization screening kit (Molecular Dimensions Ltd.), containing 30% w/v PEG500MME_P20K (10% w/v PEG 20000 ...
-
No products found
because this supplier's products are not listed.
Willy Roque, et al.,
bioRxiv - Cell Biology 2020
Quote:
SA-β-gal staining was performed using the β-galactosidase kit (Dojindo Molecular Technology, 1824699-57-1) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anqi Yu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
RNA was isolated from mouse subcutaneous tumors (six TOB1-AS1 overexpression and six control mice) after 6 weeks of PANC-1 cell subcutaneous injection using Direct-zol RNA Miniprep kit (RPI, ZR2052). Quality and quantity of the RNA was assessed using Qubit ...
-
No products found
because this supplier's products are not listed.
Eric M. Patrick, et al.,
bioRxiv - Biochemistry 2019
Quote:
... prior to binding of the complex to 1 μM diameter polystyrene beads (Spherotech) functionalized with an anti-digoxigenin antibody (Roche ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Evan Lester, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... non-specific binding sites were blocked using Super Block (Scytek), supplemented with Avidin (Vector Labs) ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Sehar Ali, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... VEGFR2 tyrosine kinase inhibitor (Vatalanib) and colony stimulating factor 1 receptor (CSF1R) inhibitor (GW2580) were purchased from LC Laboratories, Woburn ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Parul Verma, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 100 µM L-alpha-phosphatidyl-D-myo-inositol 4,5-diphosphate, dioctanoyl (PIP2, KDR enhancer) were diluted in NbActiv4 recording media (BrainBits, Springfield, IL, USA). Complete saline solution (CSS ...
-
No products found
because this supplier's products are not listed.
June-Hyung Kim, et al.,
bioRxiv - Immunology 2019
Quote:
... and 1 µg of mouse E2 (UBE2E3, Boston Biochem) in 40 µl of reaction buffer (Boston Biochem ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Ann McCartney, et al.,
bioRxiv - Genomics 2020
Quote:
... according to the manufacturer’s protocol but using150 μL Bead Binding buffer (Phase Genomics) for coupling the biotinylated molecules to the beads and continue with the Phase Genomics Hi-C kit for plants protocol ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Binding was detected with HRP-conjugated secondary antibodies and visualized by Brightfield ECL (Thomas Scientific) on the ChemiDoc (BioRad).
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Mouhamed Alsaqati, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ESGRO leukemia inhibitory factor (LIF) (Chemicon) at 37°C in an incubator (Galaxy 170R, New Brunswick, USA). The mECs media were changed daily and cells were passaged every other day using TrypLE (Gibco ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Dinh-Vinh Do, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... prepared as a 1:1 mixture of DMEM/F12 (PAN Biotech) and Neuropan basal medium (PAN Biotech ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Yongrong Qiu, et al.,
bioRxiv - Neuroscience 2022
Quote:
We recorded light stimulus-evoked Ca2+ signals in GCL cells of the explanted mouse retina using a MOM-type twophoton (2P) microscope (74, 75) from Sutter Instruments (purchased from Science Products ...