-
No products found
because this supplier's products are not listed.
Felicity Macdonald, et al.,
bioRxiv - Immunology 2021
Quote:
... IL-2 ELISA was performed using IL-2 Mouse Uncoated ELISA Kit (Invitrogen) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Pamela Swiatlowska, et al.,
bioRxiv - Cell Biology 2021
Quote:
... LIMK2 (Abcam ab45165 or CST #8C11 ...
-
No products found
because this supplier's products are not listed.
Wiebke Nahrendorf, et al.,
bioRxiv - Immunology 2020
Quote:
... We used commercially available ELISA kits to quantify plasma IFNγ (mouse IFNγ platinum ELISA extra sensitive, ebioscience), CXCL10 (mouse IP-10 platinum ELISA, ebioscience) and Angiopoietin-2 (mouse/rat Angiopoietin-2 quantine ELISA kit, R&D Systems). Absorbance was measured using a Multiskan Ascent (MTX Lab systems ...
-
No products found
because this supplier's products are not listed.
Matthias Hecht, et al.,
bioRxiv - Cell Biology 2022
Quote:
... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
No products found
because this supplier's products are not listed.
Fangfang Song, et al.,
bioRxiv - Physiology 2023
Quote:
... and mouse Igf1 ELISA kit (Mouse IGF-1 ELISA Kit, Cat#80574, Crystal Chem). HOMA-IR was calculated as follows ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse IL1α ELISA Kit (Biolegend, #433404), Mouse CXCL5 ELISA Kit (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Charles A Berdan, et al.,
bioRxiv - Cancer Biology 2019
Quote:
FAK1 kinase domain (AA393-698) (Promega) (25 μg ...
-
No products found
because this supplier's products are not listed.
Florencia P. Madorsky Rowdo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
No products found
because this supplier's products are not listed.
Ying-Chao Hsueh, et al.,
bioRxiv - Immunology 2022
Quote:
... was added to the ELISA plates that had been coated with 2 ug/ml recombinant mouse Dsg3 protein extracellular domains (MyBioSource, baculovirus expressed). The binding complexes were detected by HRP goat anti-rat IgG (BioLegend ...
-
No products found
because this supplier's products are not listed.
Moh’d Mohanad Al-Dabet, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Urine albumin was determined using a mouse albumin ELISA kit (Mouse albumin ELISA quantification kit, Bethyl Laboratories) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sieglinde Hastreiter, et al.,
bioRxiv - Physiology 2024
Quote:
ELISA: Insulin ELISA (Mouse Insulin ELISA, Mercodia) and Leptin ELISA (Quantikine Mouse/Rat Leptin Immunoassay ...
-
No products found
because this supplier's products are not listed.
Melissa B. Uccellini, et al.,
bioRxiv - Microbiology 2019
Quote:
... TNF-α ELISA was performed using the mouse TNF ELISA kit (BD OptEIA), and IFN-α ELISA was performed using the Verikine Mouse IFN Alpha ELISA Kit (PBL Assay Science ...
-
No products found
because this supplier's products are not listed.
Bastian Ramms, et al.,
bioRxiv - Physiology 2021
Quote:
Plasma insulin levels were measured after 5 h of fasting or before and 10 min after a glucose gavage (2 mg/g body weight) of fasted (5 h) mice via the mouse ultrasensitive or mouse insulin ELISA kit (Alpco).
-
No products found
because this supplier's products are not listed.
Gabriella O. Estevam, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The kinase domain variant library was digested with PstI-HF (NEB) and NdeI-HF (NEB ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Stephanie B. Garcia, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Mixed Lineage Kinase Domain Like Pseudokinase (MLKL) (Cat #14993S, Cell Signaling), Gasdermin D (CAT#93709S ...
-
No products found
because this supplier's products are not listed.
Ahmed M. Fahmy, et al.,
bioRxiv - Immunology 2023
Quote:
... 2’’3’’-cGAMP ELISA was done using the 2’’3’’-cGAMP ELISA Kit (Cayman Chemical Co.) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Karolina Wołodko, et al.,
bioRxiv - Physiology 2020
Quote:
... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
No products found
because this supplier's products are not listed.
Jeje Temitope Olawale, et al.,
bioRxiv - Pathology 2021
Quote:
A mouse IFN-γ ELISA kit (RayBiotech) was used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Davide De Forni, et al.,
bioRxiv - Microbiology 2021
Quote:
... and an ELISA assay (SARS-CoV-2 Nucleocapsid Detection ELISA Kit, Sino Biological) was performed to measure produced virus through the quantification of the viral NP nucleoprotein (a measure of viral replication capacity).
-
No products found
because this supplier's products are not listed.
Dennis M. Bjorklund, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... sBRAF kinase domain constructs were purified using glutathione affinity resin (Genscript, catalogue ...
-
No products found
because this supplier's products are not listed.
Xiaochun Xie, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse IL-1α ELISA kit (E-EL-M3059, Elabscience), and moue IFN-β ELISA kit (42410-1 ...
-
No products found
because this supplier's products are not listed.
Melissa B. Uccellini, et al.,
bioRxiv - Microbiology 2019
Quote:
... and IFN-α ELISA was performed using the Verikine Mouse IFN Alpha ELISA Kit (PBL Assay Science) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stefanos Giannakopoulos, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse LH ELISA Kit (Abclonal Cat. # RK02986). All assays using normalized protein amounts were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Agatha Lyczek, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The kinase domain c-Abl mutations were introduced into the human c-Abl kinase domain by site-directed mutagenesis using the QuikChange II kit (Agilent) and verified by DNA sequencing.
-
No products found
because this supplier's products are not listed.
Ryosuke Hiwa, et al.,
bioRxiv - Immunology 2021
Quote:
... Mouse anti-dsDNA IgG-specific ELISA Kit was from Alpha diagnostic. Mouse IL-2 DuoSet ELISA DuoSet and Ancillary Reagent Kit 2 were from R&D Systems.
-
No products found
because this supplier's products are not listed.
Amr H. Allam, et al.,
bioRxiv - Immunology 2019
Quote:
... and 5ng/mL mouse FMS-like tyrosine kinase 3 (Peprotech). Upon hematopoietic confluency every 5-8 days ...
-
No products found
because this supplier's products are not listed.
Wenjing Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... Quantitation of urinary albumin and creatinine was carried out using mouse albumin-specific ELISA kits (Roche) and creatinine determination kits (Enzymatic Method ...
-
No products found
because this supplier's products are not listed.
Abulaish Ansari, et al.,
bioRxiv - Physiology 2023
Quote:
... and apoB (Mabtech ELISA Kits) in triplicate ...
-
No products found
because this supplier's products are not listed.
Laura García-González, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 nM of recombinant catalytic domain of MT5-MMP (MT5cd, Enzo Life Science) was incubated with supernatants from GFP-transfected HEKswe at 37°C in activity buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Gavin D. Lagani, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-p70 S6 kinase alpha (Santa Cruz Biotechnology Cat# sc-8418 ...
-
No products found
because this supplier's products are not listed.
Lotta Pohjolainen, Heikki Ruskoaho, Virpi Talman,
bioRxiv - Cell Biology 2022
Quote:
The mitogen-activated protein kinase kinase 1/2 (MEK1/2) inhibitor U0126 and the p38 MAPK inhibitor SB203580 were purchased from Tocris Bioscience (Bristol ...
-
No products found
because this supplier's products are not listed.
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Seunghee Oh, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Recombinant Snf1 kinase domain (Snf1-KD) was phosphorylated by recombinant human CaMKK2 (Abnova) for its activation before kinase assays (Figure 5F) ...
-
No products found
because this supplier's products are not listed.
Yuxin Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... G-CSF was quantified by Mouse G-CSF ELISA Kit (Proteintech) according to the manufacturer’s instructions ...
-
Insulin ELISA / assay Kit
Cat# K046-H1,
1.0 ea, USD $455.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... TANK-binding kinase 1 (TBK1) and IκB kinase ε (IKKε; BX795, 2 μM; Invivogen); receptor for advanced glycation end products (RAGE ...
-
No products found
because this supplier's products are not listed.
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The ELISA for Bcl-2 was performed using a human Bcl-2 ELISA kit (LS-F4134, LSbio Lifespan Biosciences Inc, Seattle, WA, USA).
-
No products found
because this supplier's products are not listed.
Young-Cheul Shin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Soluble lysate was prepared by centrifugation and the kinase domain of FGFR1 was isolated by Ni-NTA column (Qiagen).
-
No products found
because this supplier's products are not listed.
Stefanie Koster, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 2 μM TGF-β receptor kinase Inhibitor IV (SB431542, Calbiochem), 10 μM ROCK inhibitor (Y-27632 ...
-
No products found
because this supplier's products are not listed.
K. Polak, et al.,
bioRxiv - Immunology 2020
Quote:
... or S2 domain (SARS-CoV-2 Spike S2, mouse monoclonal antibody [1A9], GTX632604, Genetex), or CilPP (in-house antibody raised in rabbit) ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Marco Costantini, et al.,
bioRxiv - Bioengineering 2020
Quote:
... anti-Dystrophin Rod Domain (mouse monoclonal, Vector Laboratories # VP-D508, diluted 1:100), anti-von Willebrand factor (rabbit polyclonal ...
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Ziva Vuckovic, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The level of phosphorylated extracellular signal-regulated protein kinase 1/2 (pERK1/2) was detected using the AlphaScreenTM SureFire Kit (PerkinElmer Life and Analytical Sciences). Briefly ...
-
No products found
because this supplier's products are not listed.
Per Greisen Jr., et al.,
bioRxiv - Bioengineering 2023
Quote:
An anti-HPC4 monoclonal mouse antibody was coated onto 96-well ELISA plates (9018, Corning) at 5 ug/ml ...
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Clara Hozer, Fabien Pifferi,
bioRxiv - Physiology 2021
Quote:
... We assayed plasma 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels (OxiSelect™ Oxidative DNA Damage Elisa kit, Cell Biolabs Inc.) and insuline-like growth-factor 1 (IGF-1 ...