-
No products found
because this supplier's products are not listed.
Steven G. Sayson, et al.,
bioRxiv - Immunology 2024
Quote:
... anti-Citrullinated Histone H3 (1:100; Abbomax, San Jose, California), or anti-Myeloperoxidase (1:100 ...
-
No products found
because this supplier's products are not listed.
Julia Ramon Mateu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... specimens were incubated in anti-phospho histone H3 antibody (ARG51679, Arigo Biolaboratories, Taiwan) diluted 1:150 in 5% NGS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... and blocked with ELISA diluent (5% nonfat milk [LabScientific, Danvers, MA, USA] in PBS-T) for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
No products found
because this supplier's products are not listed.
Stephen D. Glasgow, et al.,
bioRxiv - Neuroscience 2019
Quote:
Mouse brains were processed (FD Rapid GolgiStain Kit; FD Neurotechnologies) and cut into 100 μm sections with a cryostat ...
-
No products found
because this supplier's products are not listed.
Qi Yan Ang, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mouse fecal pellets were homogenized with bead beating for 5 min (Mini-Beadbeater-96, BioSpec) using the ZR BashingBead lysis matrix containing 0.1 and 0.5 mm beads (ZR-96 BashingBead Lysis Rack ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Each experiment began with calibration beads with QuantumTM FITC-5 MESF kits (#555p, Bangs Laboratories). Quantification and analysis were performed by using the QuickCal® v.3.0 ...
-
No products found
because this supplier's products are not listed.
Yadira M. Soto-Feliciano, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Human wild-type or mutant (K4M) histone H3.1 were cloned into pCDH-EF1-MCS-IRES-RFP (System Biosciences, CD531A-2). To express sgRNAs ...
-
No products found
because this supplier's products are not listed.
Courtney M. Mazur, et al.,
bioRxiv - Physiology 2021
Quote:
... Mice were randomized into four weight-matched groups at 7 weeks old and injected intraperitoneally with either AAV8-CAG-mOstn-WPRE or AAV8-CAG-eGFP in 100 uL saline (5*1011 genome copies/mouse, Vector Biolabs). For pilot experiments in C57BL/6J mice ...
-
No products found
because this supplier's products are not listed.
Shrikant Sharma, Gabriele Varani,
bioRxiv - Biophysics 2021
Quote:
... Deuterated RNA samples were prepared in the same way using selective deuterated rNTPs (D-H5, H3′, H4′, H5′ and H5′′) and 13C/15N-labeled samples were prepared using labeled rNTPs (Cambridge Isotope Laboratories). The resulting RNAs were purified for NMR studies by gel electrophoresis ...
-
No products found
because this supplier's products are not listed.
Uriel López-Sánchez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... solubilized at 5 mg/mL in 5% DDM (Anatrace). After 30 minutes incubation ...
-
No products found
because this supplier's products are not listed.
Zhi Yang Tan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Modifications or lack thereof to all histone genes were authenticated by PCR and Sanger sequencing (Bio Basic Asia Pacific Pte Ltd, Singapore) in all yeast strains.
-
No products found
because this supplier's products are not listed.
Olivier Binda, et al.,
bioRxiv - Biochemistry 2022
Quote:
The installation of a monomethyl-lysine analog at the mutated cysteine of the H3KC79 (C110A) histone was done as described (52) using the 2-chloro-N-methylethanamine hydrochloride (Toronto Research Chemicals C428323) to generate H3KC79me1 (C110A) ...
-
No products found
because this supplier's products are not listed.
D. Lapaillerie, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.5 ml of peripheral blood was added to 5 ml of specific culture medium (ChromoSynchroPTM kit, EuroClone, Pero, Italy), T-lymphocytes were thereby cultured for 72 hours ...
-
No products found
because this supplier's products are not listed.
Margaret Johnson Kell, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Goat anti-mouse antibodies labeled with 1.4-nm colloidal gold as well as HQ Silver enhancement kit were from Nanoprobes. DAPI solution was purchased from BD Biosciences.
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Siiri I Salomaa, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with and stained in 5 % milk in TBST and detected using WesternBright ECL Western Blotting detection kit (#K-12045-D20, Advansta). For Coomassie Blue staining ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Se-Mi Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
Purified WT or mutant NSP12 recombinant proteins were labeled with Cytidine-5 dye using the Monolith His-Tag labeling kit (NanoTemper Technologies), and then labeled NSP12 proteins were diluted to 700 nM in PBST buffer ...
-
No products found
because this supplier's products are not listed.
Cristiana Bersaglieri, et al.,
bioRxiv - Genomics 2020
Quote:
... ESCs were co-transfected with a plasmid expressing the Cas9 proteins and the sgRNA guide sequence targeting the Rosa26 locus (Genome CRISPR™ mouse ROSA26 safe harbor gene knock-in kit, SH054, GeneCopoeia) and the HDR repair template plasmid containing either H2B-Dam or H2B-Dam-NoLS constructs flanked by the homology arms with a molar ratio of 1:3.
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5(6)-CTAMRA (Carbosynth/Novabiochem); TFA (Alfa Aesar) ...
-
No products found
because this supplier's products are not listed.
Matteo Lunghi, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5% dialyzed FBS (Pan Biotech P30-2102 ...
-
No products found
because this supplier's products are not listed.
Konstantin F. Tirronen, Anastasiia S. Kuznetsova,
bioRxiv - Zoology 2023
Quote:
... 5 μL Screen Mix (Evrogen), 1 μL of each primer (10 μM ...
-
No products found
because this supplier's products are not listed.
Haleigh N. Mulholland, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a 5 MΩ electrode (FHC) was driven approximately 7 mm down perpendicularly into the brain using a micromanipulator ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shweta Chaudhary, Falak Pahwa, Ranjan K. Nanda,
bioRxiv - Biochemistry 2022
Quote:
... labelled peptides were dissolved in ammonium formate buffer (5 mM, 2 ml) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (AB Sciex, USA). Peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Michael J. Hoy, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 M Sodium Chloride (Teknova #S0251), TCEP (Soltec Ventures Inc #M115) ...
-
No products found
because this supplier's products are not listed.
Haijing Guo, Jen-Hsuan Wei, Joachim Seemann,
bioRxiv - Cell Biology 2020
Quote:
... we added 5 μg/ml puromycin (RPI) and stable clones were selected for seven days ...
-
No products found
because this supplier's products are not listed.
Desingu Ayyappa Raja, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
No products found
because this supplier's products are not listed.
Andrew P. Tosolini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... glass micropipettes (Drummond Scientific, 5-000-1001-X10), as previously described (Mohan et al. ...
-
No products found
because this supplier's products are not listed.
Victoria A. Bonnell, et al.,
bioRxiv - Genomics 2023
Quote:
... Sonicate the chromatin until sufficiently sheared (130µL, 5% duty cycle, 75W peak incident power, 200 cycles per burst, 7°C, for 5 minutes using Covaris Focus-Ultrasonicator M220). The immunoprecipitation step included ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the multi-lead electrode pedestal was connected to an amplifier (10 Hz-5 KHz band-pass filter, 5 kHz sampling rate, Model 1700 Differential AC amplifier, A-M systems, Sequim, WA, USA). The signal was recorded and integrated using Spike2 version 9.0 software (Cambridge Electronic Design).
-
No products found
because this supplier's products are not listed.
S. Mark Roe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2000 and 5000 MME) and 5% (V/V) 2-propanol at 14°C (H3 from the BCS Screen HT-96, Molecular Dimensions, MD1-105). Crystals were harvested by successive transfer into a crystallization buffer with increasing ethylene glycol content to 30% and then flash-cooled in liquid nitrogen ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Marius Regin, et al.,
bioRxiv - Developmental Biology 2023
Quote:
We warmed vitrified human blastocysts (5-6dpf) after PGT or at 3dpf using the Vitrification Thaw Kit (Vit Kit-Thaw; Irvine Scientific, USA) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anna Shiriaeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 mM TCEP hydrochloride (Hampton Research).
-
No products found
because this supplier's products are not listed.
Hwan-Ching Tai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and a 5-µm filter (Pall, 4662). The filtrate was spun at 1,000 xg for 10 mins at 4 °C ...
-
No products found
because this supplier's products are not listed.
Ricardo da Silva Antunes, et al.,
bioRxiv - Immunology 2023
Quote:
... in 5% human serum (Gemini Bio-Products) for 24 h ...
-
No products found
because this supplier's products are not listed.
Stephan Kamrad, et al.,
bioRxiv - Genetics 2019
Quote:
... column (New Objective, PF360-75-10-N-5) packed in house with 1.9 um C18 beads (Dr ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...