-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Pavel Shekhtmeyster, et al.,
bioRxiv - Neuroscience 2021
Quote:
The filter cube consisted of a custom 4.2 x 6.84 x 1 mm dual-band dichroic beamsplitter (59012-custom, Chroma Technology Corp.), 4.1 x 4.2 x 1.1/1.0 mm dual-band fluorescence excitation and emission filters (59012x and 59012m ...
-
No products found
because this supplier's products are not listed.
Mara J. Campbell, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1 x 106 cfu was then added to 1 ml of whole human blood (BioIVT). An aliquot was immediately removed ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-JFH-1 NS5A (clone 7B5, BioFront Technologies, 1:10,000). Blots were incubated for 1 hour with HRP-conjugated secondary antibodies diluted in 5% skim milk ...
-
No products found
because this supplier's products are not listed.
Yuancheng Lu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Mouse anti-Klf4 (1:1000, ReproCell, 09-0021), Rabbit anti-p-S6 (S240/244 ...
-
No products found
because this supplier's products are not listed.
Araceli Bergadà-Martínez, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-BDNF (mouse, 1:150, 327-100, Icosagen) and anti-actin (mouse ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Dennis S. Metselaar, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... glial fibrillary acidic protein (GFAP) (1:500; BT46-5002–04, BioTrend), S100 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Travis A. Lee, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Sterilized seeds were placed onto 1 X Linsmaier & Skoog media (1.0 LS salts [Caisson Labs], 0.8% agar [w/v], 1% w/v Suc., pH5.7) in 120 mm2 petri dishes at a density of 100 seeds per row for 0d and 1.25d samples ...
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Anisha Pal, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 0.5% [v/v] Triton X-100 and protease inhibitors) before being lysed by shaking with bead lysis kit (Next Advance RINO) using bullet blender Storm 24 (Next Advance) ...
-
No products found
because this supplier's products are not listed.
Daniel M. Virga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... at 512 x 512 pixels covering 330 μm x 330 μm at 30 Hz with photomultiplier tubes (green GCaMPF6f fluorescence, GaAsP PMT, Hamamatsu Model 7422-40 ...
-
No products found
because this supplier's products are not listed.
Platre Matthieu Pierre, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The pellet was resuspended in 1 mL of immunoprecipitation buffer (50 mM Tris at pH 8, 150 mM NaCl, 1% Triton X-100) using a 2-mL potter (Wheaton), and was left on a rotating wheel for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Katherine J. Turner, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rabbit anti-green fluorescent protein (GFP; Torrey Pines Biolabs, Cat# TP401, dilution 1:1000), rat anti-GFP (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Francesca Boscolo Sesillo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Slides stained for collagen I were first washed and then incubated in in blocking buffer (10% goat serum, 0.3% Triton x-100, 1% BSA (Gemini Bio-Products, 700-100P) in PBS ...
-
No products found
because this supplier's products are not listed.
S. Liu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... containing 0.1% Triton X-100 and blocked 1 hour in 5% goat serum (Jackson Immuno Research, 005-000-121) 3% BSA (Pan Biotech, P06-1391100). Rabbit anti-phospho-ubiquitin ...
-
No products found
because this supplier's products are not listed.
El Batoul Djouani-Tahri, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Total cellular proteins were labeled by adding 5 μCi mL-1 of [35S] Na2SO4 (American Radiolabeled Chemicals) for 10 min ...
-
No products found
because this supplier's products are not listed.
Aleksandra Marconi, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... specimens were cleared 3 x 20 minutes in Histosol (National Diagnostics) at room temperature ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Yibo Tang, et al.,
bioRxiv - Immunology 2023
Quote:
The conjugations of peptides to the KLH protein carrier were performed according to the manufacturer instructions of ReadiLink™ KLH Conjugation Kit (AAT Bioquest, Cat.#5502). In brief ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Gustavo A. Gomez, et al.,
bioRxiv - Genetics 2022
Quote:
... and X-ray fracture images were analyzed on a Faxitron Radiography system (Hologic, Bedford, MA). Images were acquired with 20 kV X-ray energy for 10 seconds.
-
No products found
because this supplier's products are not listed.
Elise H. Zimmerman, et al.,
bioRxiv - Microbiology 2023
Quote:
... samples were centrifuged at 6,000 x g for 7 minutes then resuspended in RNAzol RT (Molecular Research Center). Samples then underwent RNA extraction ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
Cat# GX10003,
Fixing Buffer 125ml
10X PBS 75ml
Staining Buffer 125ml 25X Stock Solution of X-Gal 4ml, USD $178.00/KIT
Ask
Tamadher A. Alghamdi, et al.,
bioRxiv - Physiology 2022
Quote:
Enzymatic X-gal staining of pancreas cryosections (5 μm thickness) was performed using an X-Gal Staining Kit (Cat#GX10003, Oz Biosciences INC, San Diego, CA, US) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Timo Baade, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 µg/mouse of IL-15 (Shenandoah Biotech) was injected three times per week with an intraperitoneal injection (ip) ...
-
No products found
because this supplier's products are not listed.
Lucia Binó, Lukáš Čajánek,
bioRxiv - Cell Biology 2023
Quote:
... ½x Zell Shield (Minerva Biolabs), 100 μmol/L ß-mercaptoethanol (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Yunfei Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Cell pellets as described above were lysed in RIPA lysis buffer (50 mM Tris, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100, protease cocktail [TargetMol], and 1 mM PMSF) at 4°C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Joseph C. Maggiore, et al.,
bioRxiv - Bioengineering 2020
Quote:
... a nerve cuff was fashioned by capping silicon tubing (A-M Systems, 807600, 0.058” x 0.077” x 0.0095”) with PDMS (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... the arrays were probed at 1/100 dilution in protein array blocking buffer (GVS) supplemented with E ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Sebastian Pöhl, et al.,
bioRxiv - Microbiology 2023
Quote:
... Protein was then purified using zinc-affinity chromatography using a 1 mL Zn-NTA column (Cube Biotech) equilibrated with lysis buffer containing 5 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Bastien Casu, et al.,
bioRxiv - Microbiology 2022
Quote:
... Streptomyces cells were mixed with 10 nm Protein A conjugated colloidal gold particles (1:10 v/v, Cytodiagnostics) and 4 µl of the mixture was applied to a glow-discharged holey-carbon copper EM grid (R2/1 or R2/2 ...
-
No products found
because this supplier's products are not listed.
Anne Bormann, et al.,
bioRxiv - Neuroscience 2023
Quote:
... first using an Ultra-Turrax (4 x 15 sec; IKA T10 Basic) and second using a glass homogenisator (squished 20x/sample) ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Alina Vaitsiankova, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5% Triton X-100) supplemented with 10 μM PARPi (KU0058948, Axon Medchem, Axon 2001) and PARGi (PDD0017273 ...
-
Pluronics 40% is a ready-to-print sacrificial and support ink that exhibits excellent printability.
Cat# IKS400000503,
5 mL, USD $70.0
Ask
John R. Ferrarone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 1.5 x 105 cells were seeded into 6-well CytoSoft plates (Advanced Biomatrix 5190). Images of these cells were taken every 4 hours using an Incucyte Zoom or Incucyte S3 live cell imaging system.
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...