-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Naushin L. Hindul, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The starved cells were growth-factor stimulated with fresh DMEM media containing 100ng/ml epidermal growth factor (EGF Human #A63411-500 (Antibodies.com)) ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Caijun Wu, et al.,
bioRxiv - Immunology 2022
Quote:
... Mouse Factor X total antigen was measured using kit from Molecular Innovations (Cat. No. MFXKT-TOT).
-
No products found
because this supplier's products are not listed.
Yasuaki Uehara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Phosphate homeostasis hormones were measured in mouse and human serum using the FGF-23 ELISA Kit (Kainos Laboratories Inc., Tokyo, Japan), the mouse or human PTH 1-84 ELISA Kit (Immutopics ...
-
No products found
because this supplier's products are not listed.
Jenna J. Guthmiller, et al.,
bioRxiv - Immunology 2021
Quote:
... 1 part serum was treated with 3 parts Receptor Destroying Enzyme II (Seiken, Hardy Diagnostics) for 18 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... naïve WT cells were plated on irradiated MEF (mouse embryonic fibroblast conditions)/Gelatin coated plates in HENSM supplemented with ROCKi 10 µM (Axon Medchem 1683). The next day ...
-
No products found
because this supplier's products are not listed.
Keng Hou Mak, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and were maintained in mesothelial cell growth medium (MSO-1, Zen-Bio, Inc.). Human cervical adenocarcinoma cell line HeLa from American Type Culture Collection was maintained in DMEM medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Michael J. Robertson, et al.,
bioRxiv - Biophysics 2022
Quote:
All receptors were expressed in Sf9 insect cells (Expression Systems) infected at a density of 3-4 million cells/ml ...
-
No products found
because this supplier's products are not listed.
Anna Tasegian, et al.,
bioRxiv - Physiology 2024
Quote:
... a 50% conditioned media (1:1 dilution in advanced D-MEM/F12 base media) was generated from genetically modified L-WRN mouse fibroblast cell line (ATCC, #CLR-3276™, ATCC, LGC Standards, Middlesex, UK) cultured in advanced D-MEM/F12 (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
Human factor α-XIIa (Enzyme Research Laboratories Ltd) activity was measured at an enzyme concentration of 0.17 U/mL in 150 mM NaCl and 50 mM Tris-HCl (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Juliane Tschuck, et al.,
bioRxiv - Cell Biology 2023
Quote:
For inhibition of different receptors and proteins we used HX 531 (Biomol) as a pan-Retinoic Acid Receptor (RAR ...
-
No products found
because this supplier's products are not listed.
Carolina Franco Nitta, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Transfected cells were selected for stable integration by growth in 1 mg/ml G418 (Caisson Labs) for 7 days ...
-
No products found
because this supplier's products are not listed.
Eliona Tsefou, et al.,
bioRxiv - Neuroscience 2021
Quote:
For mRNA transfection in fibroblasts mRNA’s were synthesised de novo (Trilink Biotechnologies) using cDNA sequences for USP30 (accession NM_032663 ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
Cat# G209,
USD $10.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse GAPDH (5G4MaB6C5, HyTest; 1:20.000 WB), Alexa Fluor 488 Phalloidin (Invitrrogen ...
-
No products found
because this supplier's products are not listed.
Gracious Yoofi Donkor, et al.,
bioRxiv - Microbiology 2023
Quote:
... Growth was performed in DuoClick™ (Thomas Scientific) screw cap culture tubes filled with minimal room ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yitong Ma, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The growth media consisted of Alpha MEM Earle’s Salts (Irvine Scientific) with 10% Tet Approved FBS (Clontech Laboratories or Avantor ...
-
No products found
because this supplier's products are not listed.
Dianrong Li, et al.,
bioRxiv - Cell Biology 2021
Quote:
Antibodies for mouse RIPK3 (#2283; WB, 1:1000; IHC, 1:100) were obtained from ProSci. There other antibodies used in this study were anti-RIPK3(LS-C336804 ...
-
No products found
because this supplier's products are not listed.
Lorraine R Horwitz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse anti-Calb1 (1:500,# MCA-5A9, EnCor Biotech Gainesville, FL), or rabbit anti-c-Fos (1:500 ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 0.05% Triton X-100 in 1X PBS pH 7.2 supplemented with mouse-on-mouse blocking reagent (Vector Biolabs; 1:50) and Fc receptor blocker reagent (Innovex Biosciences ...
-
No products found
because this supplier's products are not listed.
Eri Morimoto, Kotaro Tsuboyama, Yukihide Tomari,
bioRxiv - Biochemistry 2022
Quote:
... Anti-mouse antibody was used as the secondary antibody at 1:100 (Protein Simple).
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Yui Ozawa, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Seeds were placed on wet paper and kept at 4°C overnight and then transferred to a growth chamber (FHC-740 ...
-
No products found
because this supplier's products are not listed.
Christian Stocker, et al.,
bioRxiv - Biochemistry 2023
Quote:
... *JbCDTCM crystals were obtained at 20 °C from a 1:1 (200 nL:200 nL) mixture of protein sample and solution C1 from the Morpheus crystallization screening kit (Molecular Dimensions Ltd.), containing 30% w/v PEG500MME_P20K (10% w/v PEG 20000 ...
-
No products found
because this supplier's products are not listed.
Dinh-Vinh Do, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Linyuan Shi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The GABAA receptor positive allosteric modulator indiplon (AdooQ Biosciences) or the GSK3β inhibitor AR-A104418 (AdooQ Biosciences ...
-
No products found
because this supplier's products are not listed.
Susanne N. Walker, et al.,
bioRxiv - Immunology 2020
Quote:
... Followed by capture of SARS-CoV-2 receptor binding domain which was biotinylated using the lightning-link type-A biotinylation kit(Expedeon/Abcam, 370-0005) for 180s at 10ul/min ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and Primary Human IPF Lung Parenchymal Fibroblasts (Donor2) (BioIVT, #PCR-70-0214) were incubated at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Briana N Markham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-GAPDH (Meridian Life Sciences, H86504M, 1:750,000), mouse IgG2b anti-PINK1 (Novus ...
-
No products found
because this supplier's products are not listed.
Samuel A. Adeleye, Srujana S. Yadavalli,
bioRxiv - Microbiology 2023
Quote:
Routine bacterial growth on solid agar was performed using LB Miller medium (IBI scientific) containing 1.5% bacteriological grade agar (VWR Lifesciences ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Rukshala Illukkumbura, et al.,
bioRxiv - Cell Biology 2022
Quote:
... using a hypodermic needle into 7.5 μl of Shelton’s Growth Medium (SGM) containing 18.8 μm polystyrene beads (Polybead, Polyscience, Inc. Cat. # 18329). These were mounted between a glass slide and a high precision 1.5H 22 mm x 22 mm glass coverslip ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
No products found
because this supplier's products are not listed.
Yongrong Qiu, et al.,
bioRxiv - Neuroscience 2022
Quote:
We recorded light stimulus-evoked Ca2+ signals in GCL cells of the explanted mouse retina using a MOM-type twophoton (2P) microscope (74, 75) from Sutter Instruments (purchased from Science Products ...