-
No products found
because this supplier's products are not listed.
Katarzyna Szymanska, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and maintained in Fibroblast Growth Medium (Genlantis Inc. San Diego, CA) supplemented with 0.2 mg/ml geneticin ...
-
No products found
because this supplier's products are not listed.
Caijun Wu, et al.,
bioRxiv - Immunology 2022
Quote:
... Mouse Factor X total antigen was measured using kit from Molecular Innovations (Cat. No. MFXKT-TOT).
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mouse embryonic fibroblasts (MEFs) were cultured using DMEM (Wisent Bioproducts: 4.5 g/L glucose ...
-
The PureCol® lyophilized product comes with 15 mg of type I bovine atelocollagen used for 2D...
Cat# 5006-15MG,
15 mg, USD $230.0
Ask
Ross C. Bretherton, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 250,000 WT cardiac fibroblasts were seeded onto an ECM Select Array Kit Ultra-36 (Advanced Biomatrix) and cultured for 24 hours in EdU-containing media as above ...
-
No products found
because this supplier's products are not listed.
Laura E. Newman, et al.,
bioRxiv - Cell Biology 2022
Quote:
Tfam+/− MEFs (TFAM Het MEF) and SV40 mouse embryonic fibroblasts (SV40 MEF) were cultured on R ¼ Carbon 200-mesh gold electron microscopy grids (Quantifoil Micro Tools) and plunge frozen in a liquid ethane/propane mixture using a Vitrobot Mark 4 (Thermo Fischer Scientific) ...
-
No products found
because this supplier's products are not listed.
Darryl Hayward, et al.,
bioRxiv - Immunology 2021
Quote:
... in combination with Alexa Flour 633-conjugated anti-PNAd (MECA-79, 15 μg/mouse, Nanotools) to visualize HEV ...
-
No products found
because this supplier's products are not listed.
Anna Tasegian, et al.,
bioRxiv - Physiology 2024
Quote:
... a 50% conditioned media (1:1 dilution in advanced D-MEM/F12 base media) was generated from genetically modified L-WRN mouse fibroblast cell line (ATCC, #CLR-3276™, ATCC, LGC Standards, Middlesex, UK) cultured in advanced D-MEM/F12 (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Matthew D. J. Dicks, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Human coagulation Factor X (hFX) (Haematologic Technologies) was added to diluted vectors at a final concentration of 8 μg/mL ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
Human factor α-XIIa (Enzyme Research Laboratories Ltd) activity was measured at an enzyme concentration of 0.17 U/mL in 150 mM NaCl and 50 mM Tris-HCl (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Callan O’Connor, et al.,
bioRxiv - Genetics 2023
Quote:
... fibroblast media was replaced by monomethylarsonous acid (MMAIII; Toronto Research Chemicals) containing 100 µL of fibroblast media at concentrations of 0 µM ...
-
No products found
because this supplier's products are not listed.
Kuo Du, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Cell growth/viability was monitored with Cell Counting Kit-8 according to manufacturer’s instructions (CCK8, Dojindo Molecular Technologies). For RT-PCR and western blot assay ...
-
No products found
because this supplier's products are not listed.
Mónika Z. Ballmann, et al.,
bioRxiv - Immunology 2021
Quote:
... The FX coagulation factor was purchased from Cambridge Bioscience and used at a physiological concentration of 10 µg/ml ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and Primary Human IPF Lung Parenchymal Fibroblasts (Donor2) (BioIVT, #PCR-70-0214) were incubated at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Eliona Tsefou, et al.,
bioRxiv - Neuroscience 2021
Quote:
For mRNA transfection in fibroblasts mRNA’s were synthesised de novo (Trilink Biotechnologies) using cDNA sequences for USP30 (accession NM_032663 ...
-
No products found
because this supplier's products are not listed.
Firyal Ramzan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or alkyne-palmitate (15-hexadecynoic acid; 15-HDYA; Click Chemistry Tools 1165) were saponifed in potassium hydroxide ...
-
No products found
because this supplier's products are not listed.
Jennine M. Dawicki-McKenna, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 15% glycerol (Amresco #M152), 3.75 mM EDTA ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Gracious Yoofi Donkor, et al.,
bioRxiv - Microbiology 2023
Quote:
... Growth was performed in DuoClick™ (Thomas Scientific) screw cap culture tubes filled with minimal room ...
-
Cat# IMS217-Rinse_435,
USD $39.0/2 x 15ml
Ask
Milica Moskovljevic, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells stimulated with either lysates of CMV-infected fibroblasts (Virusys, 10 μg/mL), overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Gokul Swaminathan, et al.,
bioRxiv - Immunology 2021
Quote:
... following the Mouse Anti-OVA IgG Antibody Assay Kit (Chondrex), or as previously described (76).
-
No products found
because this supplier's products are not listed.
Danny D. Sahtoe, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 15% PEG 4000 (Molecular dimensions) before the crystals were harvested in 25% glycerol as a cryoprotectant ...
-
No products found
because this supplier's products are not listed.
Duilio M. Potenza, et al.,
bioRxiv - Physiology 2024
Quote:
... and human cardiac fibroblasts was extracted with Trizol Reagent (TR-118, Molecular Research Center) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Luca Ferrari, Stefan G.D. Rudiger,
bioRxiv - Biochemistry 2019
Quote:
... 15% SDS gels were prepared (Separation buffer: 0.38 M Tris pH 8.8, 15% acrylamide(National Diagnostics), 0.1% SDS ...
-
No products found
because this supplier's products are not listed.
Jenna M. Vickery, et al.,
bioRxiv - Microbiology 2023
Quote:
... an IRIS 15 cMOS camera (Photometrics), Semrock Brightline filters ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Adam F. Odell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... were seeded to fibronectin (Sigma)-coated E-plates (growth) or CIM plates (migration) (ACEA Biosciences, Inc.) and analysed using xCELLigence RTCA DP instrument ...
-
No products found
because this supplier's products are not listed.
Julia Fath, et al.,
bioRxiv - Cell Biology 2022
Quote:
... first-strand cDNA synthesis (0.6 μg of total RNA per 15 μl reaction) was performed using olig-dT (Reverse Transcription Core Kit; Eurogentec, Seraing, Belgium). Real-time PCR was carried out with the Light Cycler Fast Start DNA Master SYBR Green Kit (Roche Applied Science ...
-
No products found
because this supplier's products are not listed.
Kati J. Ernst, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and PCR Clean wipes (Minerva Biolabs 15-2001) prior to sample processing ...
-
No products found
because this supplier's products are not listed.
Kapil Gupta, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... a commercial monoclonal antibody (Absolute Antibody; Sb#15) recognizing the S protein receptor-binding domain (RBD ...
-
No products found
because this supplier's products are not listed.
Thomas Vogels, Gréta Vargová, Tomáš Hromádka,
bioRxiv - Neuroscience 2024
Quote:
... Glass micropipettes (Drummond Scientific Company, ∼15 μm tip diameter) were used to inject the AAV into the cortex with minimal damage to neural tissue and minimal AAV leakage to the surface.
-
No products found
because this supplier's products are not listed.
Samuel A. Adeleye, Srujana S. Yadavalli,
bioRxiv - Microbiology 2023
Quote:
Routine bacterial growth on solid agar was performed using LB Miller medium (IBI scientific) containing 1.5% bacteriological grade agar (VWR Lifesciences ...
-
No products found
because this supplier's products are not listed.
Mahla Poudineh, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 15-µm SuperAvidin-coated microspheres were obtained from Bangs Laboratories, human whole blood was obtained from BioIVT ...
-
No products found
because this supplier's products are not listed.
Manon Defaye, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and mouse IgG control (300ng/mouse, Leinco Technologies, I-536,) were dissolved in sterile PBS and administered intrathecally ...
-
No products found
because this supplier's products are not listed.
Mario A Miranda, et al.,
bioRxiv - Genomics 2021
Quote:
... or isocaloric low-fat diet (15% kcal from fat; Research Diets D12284), as previously described21 ...
-
No products found
because this supplier's products are not listed.
Anne Bormann, et al.,
bioRxiv - Neuroscience 2023
Quote:
... first using an Ultra-Turrax (4 x 15 sec; IKA T10 Basic) and second using a glass homogenisator (squished 20x/sample) ...
-
No products found
because this supplier's products are not listed.
Lola Holcomb, et al.,
bioRxiv - Microbiology 2023
Quote:
... Mouse serum samples were diluted 10-fold using the kit-specific reagent (SPCKA-MP-007374, Protein Simple, Bio-Techne), and the concentrations were measured following the manufacturer’s instructions on the Ella system ...
-
No products found
because this supplier's products are not listed.
Abigail Hui En Chan, et al.,
bioRxiv - Genomics 2022
Quote:
... containing 15 µl of 2X i-TaqTM mastermix (iNtRON Biotechnology, Gyeonggi, South Korea), 10 µM to 50 µM of each primer and template DNA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
E.A. Rosado-Olivieri, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse J2 dsRNA (SCICONS; 1;1,000), phospho Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Jingnan Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... mouse anti-mCherry (1:1000, Abbkine Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Asad U. Malik, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Subsequent supernatants were run on 15 ml of Cobalt-Agarose resin (Amintra Cobalt NTA Affinity Resin, Expedeon), previously equilibrated in E ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C18AQ 3 µm) to a length of 15 cm and fitted to the Eksigent nano \LC (AB SCIEX). The eluted peptides were reconstituted in 100 μl 2% acetonitrile in 0.1% formic acid (LC-MS Buffer A ...
-
No products found
because this supplier's products are not listed.
Wafaa B. Alsoussi, et al.,
bioRxiv - Immunology 2022
Quote:
... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
No products found
because this supplier's products are not listed.
Peter Kirchweger, et al.,
bioRxiv - Microbiology 2019
Quote:
... 1 mM EDTA and 15 mM NaCl) with 1 μL reservoir solution and 2 μL of perfluoropolyether cryo-oil (Hampton research). The crystals were harvested ...
-
No products found
because this supplier's products are not listed.
Myra Hosmillo, et al.,
bioRxiv - Microbiology 2019
Quote:
Mouse G3BP1 cDNAs were subcloned into pCDH-MCS-T2A-puro-MSCV lentiviral vector (System Biosciences) by NEBuilder HiFi DNA assembly (New England Biolabs) ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Sirisha Thippabhotla, Cuncong Zhong, Mei He,
bioRxiv - Bioengineering 2019
Quote:
The RNA library was prepared by using the commercial library preparation kit NEXTflex small RNA sequencing kit (Bioo Scientific, NOVA-5132-05) following the recommended protocol by the manufactures ...