-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Maternal serum samples collected at 0.6 G were analyzed for C-reactive protein (CRP) using an hsCRP ELISA kit (MP Biomedicals, Solon, OH) according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences ...
-
No products found
because this supplier's products are not listed.
Ezequiel Miron, et al.,
bioRxiv - Genomics 2020
Quote:
... BAC probes were directly labelled by nick translation using CF-594 (Biotium).
-
No products found
because this supplier's products are not listed.
Alexandra Lucas, et al.,
bioRxiv - Neuroscience 2021
Quote:
... solution (Liberate Antibody Binding Solution, Polysciences, Inc ...
-
No products found
because this supplier's products are not listed.
Oswaldo Tostado-Islas, et al.,
bioRxiv - Microbiology 2020
Quote:
... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
No products found
because this supplier's products are not listed.
Dipti Rai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2-3 μl of protein was applied to glow-discharged carbon-coated copper grids (EMS; CF-400-Cu) and incubated for 45 s at room temperature ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Danilo Correa Pinto Junior, et al.,
bioRxiv - Physiology 2023
Quote:
... Mouse circulating osteocalcin was measured by ELISA (Quidel kit Cat #60-1305). Blood testosterone levels were determined by RIA (Testo-US Cisbio Bioassays) ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Biao Zhou, et al.,
bioRxiv - Microbiology 2021
Quote:
... both the saturating binding concentrations of antibodies and of the ACE2 protein (ACROBiosystems) for the immobilized SARS-CoV-2 spike protein were determined separately ...
-
No products found
because this supplier's products are not listed.
Cristian Soitu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... with translation stage and overhead illuminator (Olympus IX3 with filters). Brightness and contrast was enhanced by 20% for these images ...
-
No products found
because this supplier's products are not listed.
Barbara López-Longarela, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... purpose-bred male Sprague Dawley rats (age at initiation of dosing: 9-10 weeks) were supplied by Charles River Laboratories (Calco ...
-
No products found
because this supplier's products are not listed.
Brooke K. Hayes, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3 μL of 3 mg/mL of protein was added to glow discharged UltrAuFoil holey gold grid (Quantifoil GmbH) using a Vitrobot Mark IV (Thermofisher ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004183,
5 gm, $900.00
Ask
Fan Zhang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the mouse knee was minced into small fragments and digested with 3 mg/ml collagenase type I (Worthington) and 4 mg/ml dispase (Roche ...
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
Pawel Leznicki, et al.,
bioRxiv - Biochemistry 2021
Quote:
... LD membrane proteins and control proteins were synthesised in parallel either in the presence or absence of ER-derived dog pancreatic microsomes at 30°C for 7 min and further translation initiation was blocked with 0.1 mM aurintricarboxylic acid (Alfa Aesar, cat. number A15905). Samples were incubated at 30°C for a further 8 min ...
-
No products found
because this supplier's products are not listed.
Carla E. M. Golden, et al.,
bioRxiv - Neuroscience 2023
Quote:
... with the mouse/rat estradiol ELISA kit from Calbiotech (ES180S-100) after determining stage with the method described above in 18 rats (4 in proestrus > 5 hours before lights out ...
-
No products found
because this supplier's products are not listed.
Sunam Gurung, et al.,
bioRxiv - Pathology 2022
Quote:
Adult timed pregnant female olive baboons (early gest n=4 Dams 1-4E; mid-gest n=3, Dams 1-3M) were utilized for this study ...
-
No products found
because this supplier's products are not listed.
Mariska S. Simpson, et al.,
bioRxiv - Cell Biology 2023
Quote:
... His-tagged proteins were affinity purified by binding to cobalt resin (GoldBio) equilibrated in 1X PBS ...
-
No products found
because this supplier's products are not listed.
Chen Su, Yuxin Wang, Xiaoke Yang, Junyu Xiao,
bioRxiv - Biochemistry 2023
Quote:
... The bound proteins were eluted with the binding buffer supplemented with 10 mM desthiobiotin (IBA Lifesciences). The samples were analyzed by SDS-PAGE and detected by immunoblotting using antibodies to the strep tag (1:3,000 ...
-
No products found
because this supplier's products are not listed.
Noy Sadot Muzika, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Successful calli initiations (80%-100%) were characterized at 21- and 28-days post culturing using stereomicroscope (Nikon SMZ25, X5 magnification) and viewed using NIS-elements program (Nikon) ...
-
No products found
because this supplier's products are not listed.
Dongsoo Lee, Juyoung Kim, Stephen A. Baccus,
bioRxiv - Neuroscience 2024
Quote:
... Translation was controlled by a motorized micromanipulator (MP-285A, Sutter Instrument). Emission light was directed to a long-pass dichroic mirror (FF775-Di01 ...
-
No products found
because this supplier's products are not listed.
Jane A. Mitchell, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... from 3 individual donors were cultured according to suppliers instructions in full endothelial growth factor-2 media (Promocell, Germany) supplemented with 10% fetal calf serum (Biosera ...
-
No products found
because this supplier's products are not listed.
David Knorr, et al.,
bioRxiv - Immunology 2023
Quote:
... Antibody binding was visualized using secondary anti-mouse/anti-rabbit polymer HRP followed with TSA-Opal reagents (Akoya NEL811001KT). Tissue slides were incubated with DAPI as a counterstain and coverslipped with VectaShield mounting media (Vector Labs) ...
-
No products found
because this supplier's products are not listed.
Mustafa Burak Acar, et al.,
bioRxiv - Microbiology 2022
Quote:
FASP Protein Digestion Kit (Expedeon, UK) was used in the sample preparation process ...
-
No products found
because this supplier's products are not listed.
Farès Ousalem, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein samples were injected onto a Yarra 3 µm SEC-2000 (Phenomenex) running at room temperature in 150 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Petra Kangas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For depletion of the most abundant proteins from CSF ProteoSpin Abundant Serum Protein depletion kit (Norgen Biotek) was used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicole M. Davis, et al.,
bioRxiv - Pathology 2021
Quote:
... body temperatures were measured using a thermocouple thermometer and mouse rectal probe (World Precision Instruments, RET-3). Blood glucose measurements were obtained with 2uL of tail vein blood analyzed with a Bayer CONTOUR Blood Glucose Monitor and Test Strips ...
-
No products found
because this supplier's products are not listed.
Thomas J. Cahill, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Macrophages were incubated with 3 ug/mL biotinylated Hyaluronan binding protein (Amsbio) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Hongmei Qiao, et al.,
bioRxiv - Genomics 2020
Quote:
... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H) is used followed by development in Betazoid DAB kit (Biocare Medical #BDB2004).
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2021
Quote:
... Binding and internalization were quantified by RETRO-TEK HIV-1 p24 ELISA according to manufacturer instructions (ZeptoMetrix Corporation).
-
No products found
because this supplier's products are not listed.
Destiny J. Davis, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cellulose was labeled with GFP-CBM3a (family 3 carbohydrate binding module; NZYtech, Lisboa, Portugal) following fixation with 1.5% PFA (PFA ...
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and Halo-tagged upstream binding factor (AICS-0086 cl.147) were plated on Matrigel coated Ibidi 35 mm µ-Dishes (Ibidi, #81156). The cells were then imaged using a CSU-W1 spinning disc (Yokogawa ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Sinéad Kinsella, et al.,
bioRxiv - Immunology 2023
Quote:
... Gasdermin D was measured in freshly isolated thymocytes using Gasdermin D (mouse) ELISA Kit (Adipogen Life Sciences, AG-45B-0011-KI01). Lactate dehydrogenase was assessed from the supernatant of harvested thymocytes using Lactate Dehydrogenase assay (Abcam ...
-
No products found
because this supplier's products are not listed.
Grant Kemp, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The PUREfrex in vitro transcription-translation system was produced by Eurogentec and purchased via BioNordika ...
-
No products found
because this supplier's products are not listed.
Ali E. Yesilkanal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Reduced Growth Factor (Trevigen, 3445-005-01 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Magdalena Murr, et al.,
bioRxiv - Microbiology 2023
Quote:
... binding of peroxidase-conjugated species-specific secondary antibodies (Dianova) was detected by chemiluminescence substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
A. Louise Hunter, et al.,
bioRxiv - Physiology 2020
Quote:
... Here the raw data was searched against the mouse Swissprot database (release October 2017) using the paragon algorithm on Protein-Pilot (Version 5.0.1, AB SCIEX). A total of 33847 proteins were searched ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were checked for purity and presence of protein using 15% SDS-PAGE (Polyacrylamide gel electrophoresis, Mini Protean 3 System, Bio-Rad) and Coomassie Brilliant Blue (Merck ...
-
No products found
because this supplier's products are not listed.
Koki Ueda, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Serum vitamin D (25(OH)D) levels of mouse serum samples were assessed by commercially available ELISA kits (Eagle Biosciences, Inc ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Valerie Le Sage, et al.,
bioRxiv - Microbiology 2019
Quote:
... mouse anti-Matrix Protein (Kerafast, Inc.; EMS009) or goat anti-Influenza A Virus (Abcam ...