-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... coli in vitro transcription and translation (IVTT) system (Rapid Translation System, Biotechrabbit, Berlin, Germany) and printed on nitrocellulose-coated glass AVID slides (Grace Bio-Labs, Inc., Bend, OR, USA) using an Omni Grid Accent robotic microarray printer (Digilabs ...
-
No products found
because this supplier's products are not listed.
Jing Zeng, et al.,
bioRxiv - Genetics 2023
Quote:
... 100 ng ml-1 Preclinical Stem Cell Growth Factor (SCF) (CellGenix, cat# 1418- 050) and 100 ng ml-1 Preclinical FMS-like Tyrosine Kinase 3 Ligand (FLT3L ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Sehar Ali, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... VEGFR2 tyrosine kinase inhibitor (Vatalanib) and colony stimulating factor 1 receptor (CSF1R) inhibitor (GW2580) were purchased from LC Laboratories, Woburn ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Briana N Markham, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse anti-GAPDH (Meridian Life Sciences, H86504M, 1:750,000), mouse IgG2b anti-PINK1 (Novus ...
-
No products found
because this supplier's products are not listed.
Dianrong Li, et al.,
bioRxiv - Cell Biology 2021
Quote:
Antibodies for mouse RIPK3 (#2283; WB, 1:1000; IHC, 1:100) were obtained from ProSci. There other antibodies used in this study were anti-RIPK3(LS-C336804 ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 0.05% Triton X-100 in 1X PBS pH 7.2 supplemented with mouse-on-mouse blocking reagent (Vector Biolabs; 1:50) and Fc receptor blocker reagent (Innovex Biosciences ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Aiten Ismailova, et al.,
bioRxiv - Genetics 2022
Quote:
... DNA fragments were purified using a PCR purification kit (FAGCK001-1, Favorgen) and were analyzed by qPCR ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Genomics 2020
Quote:
FFPE samples of adult mouse and mouse embryo were obtained from Zyagen (San Diego, CA). According to Zyagen protocol ...
-
No products found
because this supplier's products are not listed.
Christian Stocker, et al.,
bioRxiv - Biochemistry 2023
Quote:
... *JbCDTCM crystals were obtained at 20 °C from a 1:1 (200 nL:200 nL) mixture of protein sample and solution C1 from the Morpheus crystallization screening kit (Molecular Dimensions Ltd.), containing 30% w/v PEG500MME_P20K (10% w/v PEG 20000 ...
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... The purified viruses were quantified by solid-phase indirect ELISA (Supplementary methods) and tested in an Octet RED bio-layer interferometer (Pall ForteBio, California, CA, USA) for receptor binding against sialoglycopolymers - α2,3-α1-4(6-HSO3)GlcNAc (3SLN(6-su)) ...
-
No products found
because this supplier's products are not listed.
Willy Roque, et al.,
bioRxiv - Cell Biology 2020
Quote:
SA-β-gal staining was performed using the β-galactosidase kit (Dojindo Molecular Technology, 1824699-57-1) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dinh-Vinh Do, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Falak Pahwa, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
No products found
because this supplier's products are not listed.
Anqi Yu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
RNA was isolated from mouse subcutaneous tumors (six TOB1-AS1 overexpression and six control mice) after 6 weeks of PANC-1 cell subcutaneous injection using Direct-zol RNA Miniprep kit (RPI, ZR2052). Quality and quantity of the RNA was assessed using Qubit ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was intraperitoneally injected with 100 mg/kg BrdU (APExBIO, Houston, TX, USA) dissolved in saline ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
J. Tabitha Hees, Angelika B. Harbauer,
bioRxiv - Neuroscience 2023
Quote:
Primary mouse hippocampal neurons were seeded in 24-well glass bottom plates (CellVis) at a density of 100*103 cells per well and maintained as described above ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Charles R. Heller, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 - 4 tungsten micro-electrodes (FHC, 1-5 MΩ) were inserted to characterize the tuning and response latency of the region of cortex ...
-
No products found
because this supplier's products are not listed.
Dhruv Raina, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... prepared as a 1:1 mixture of DMEM/F12 (PAN Biotech) and Neuropan basal medium (PAN Biotech ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Jeonghwan Youk, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-ABCA3 (1:300, Seven Hills Bioreagents, WRAB-ABCA3), and mouse anti-TP63 (1:500 ...
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Mouhamed Alsaqati, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ESGRO leukemia inhibitory factor (LIF) (Chemicon) at 37°C in an incubator (Galaxy 170R, New Brunswick, USA). The mECs media were changed daily and cells were passaged every other day using TrypLE (Gibco ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Christopher Deich, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... followed by 1% agarose gel electrophoresis and gel purification using a gel extraction kit (Epoch Life Science, 2260050). Recovered PCR products were digested with SpeI-HF and MluI-HF ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
No products found
because this supplier's products are not listed.
Eugene Serebryany, et al.,
bioRxiv - Biophysics 2022
Quote:
... mixed 1:1 with 4 M ammonium sulfate (Teknova) and centrifuged for 10 min. ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...