-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Siyu Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mouse hut (Braintree Scientific), nestlets and hydrogel (Bio-Serv).
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
D.J. Powell, E. Marder, M.P. Nusbaum,
bioRxiv - Neuroscience 2020
Quote:
... with manual initiation and cessation using a model 3800 stimulator (A-M Systems) via model 3820 stimulus isolation units (A-M Systems) ...
-
Cat# H1K237-5,
USD $1095.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cytosolic translation was stopped using harringtonine (200μM, Carbosynth) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... coli in vitro transcription and translation (IVTT) system (Rapid Translation System, Biotechrabbit, Berlin, Germany) and printed on nitrocellulose-coated glass AVID slides (Grace Bio-Labs, Inc., Bend, OR, USA) using an Omni Grid Accent robotic microarray printer (Digilabs ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
LC Laboratories' Product Number I-5022 - Ixabepilone, Free Base (Azaepothilone B, BMS-247550,...
Cat# I-5022, SKU# I-5022_1mg,
1 mg, $129.00
Ask
Emilie Dambroise, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... zebrafish with an SL of 7mm at treatment initiation received intraperitoneal administrations of BGJ398 (2 mg/kg body weight) (infigratinib; LC Laboratories) or vehicle (3.5 mM HCl ...
-
No products found
because this supplier's products are not listed.
Eric M. Patrick, et al.,
bioRxiv - Biochemistry 2019
Quote:
... prior to binding of the complex to 1 μM diameter polystyrene beads (Spherotech) functionalized with an anti-digoxigenin antibody (Roche ...
-
Kit consists of 1-500mL SF-4Z0-500-S Serum-Free Medium, 1-10mL vial of Attachment Factor™ and...
Cat# SF-4Z0-500-S,
510.0 mL, $250.0
Ask
Ariana Umana, et al.,
bioRxiv - Microbiology 2019
Quote:
... cell attachment factor (Cell Systems) and a thin lining of collagen (5mg/ml_ ...
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
HIF-2a translation inhibitor
Sold for research purposes only.
Cat# 2614.0, SKU# 2614-25 mg,
25mg, US $203.50 / EA, EURO, €185 / EA
Ask
Nikolay A. Aleksashin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... cell-free translation systems were pretreated with the indicated concentrations of A-92 (Axon MedChem), C-16 (Cayman Chemical) ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... binding on silica columns (IBI scientific, IB47207) with 4 volumes of guanidine thiocyanate (4.125 M guanidine thiocyanate ...
-
No products found
because this supplier's products are not listed.
Danya Abazari, et al.,
bioRxiv - Neuroscience 2022
Quote:
Protein palmitoylation assay was performed using CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), as described by manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Edmundo G. Vides, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mouse anti-Rab10 (1:1000, Nanotools); and rabbit anti-phospho Rab10 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Isadora Matias, et al.,
bioRxiv - Neuroscience 2021
Quote:
Protein concentration in cell extracts was measured by the BCA Protein Assay Kit (Cole-Parmer). Forty micrograms protein/lane was electrophoretically separated on a 10% SDS polyacrylamide gel and electrically transferred onto a Hybond-P PVDF transfer membrane (Millipore ...
-
No products found
because this supplier's products are not listed.
Lydia Maus, et al.,
bioRxiv - Neuroscience 2019
Quote:
Single-axis tilt series were acquired on a JEOL JEM-2100 200kV transmission electron microscope from −60° to + 60° in 1° increments and binned by a factor of two at 30,000 times magnifications with an Orius SC1000 camera (Gatan) using SerialEM for acquiring automated tilt series (Mastronarde ...
-
No products found
because this supplier's products are not listed.
Umar Butt, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse GAPDH (5G4MaB6C5, HyTest; 1:20.000 WB), Alexa Fluor 488 Phalloidin (Invitrrogen ...
-
No products found
because this supplier's products are not listed.
Robert C. Hurt, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and a DNA-binding plate from Epoch Life Sciences (2020-001). All constructs were verified by whole-plasmid sequencing (Primordium Labs).
-
No products found
because this supplier's products are not listed.
Joanna J. Moss, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and anti-mouse (G32-62G, 1:10,000, SignalChem) horseradish peroxidase-conjugated antibodies at room temperature for 1 hr before exposure on photographic film (28906844 ...
-
No products found
because this supplier's products are not listed.
Arun Prasath Damodaran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... mouse anti-His tag (HIS.H8 / EH158, Covalab, 1:2500), mouse anti-FLAG tag (clone M2-F1804 ...
-
No products found
because this supplier's products are not listed.
Xuelei Lai, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Proteins were produced using in vitro transcription and translation system using wheat germ extract following manufactures’ instructions (SP6 High Yield Expression System from Promega). Briefly ...
-
No products found
because this supplier's products are not listed.
Ann McCartney, et al.,
bioRxiv - Genomics 2020
Quote:
... according to the manufacturer’s protocol but using150 μL Bead Binding buffer (Phase Genomics) for coupling the biotinylated molecules to the beads and continue with the Phase Genomics Hi-C kit for plants protocol ...
-
No products found
because this supplier's products are not listed.
Leonid Andronov, et al.,
bioRxiv - Microbiology 2023
Quote:
... mouse monoclonal anti-dsRNA (SCICONS, 10010200, 1:200, 5 µg/mL), rabbit polyclonal anti-RdRp/nsp12 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Binding was detected with HRP-conjugated secondary antibodies and visualized by Brightfield ECL (Thomas Scientific) on the ChemiDoc (BioRad).
-
No products found
because this supplier's products are not listed.
Heather Swann, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 1:5 dilution of goat anti-mouse IgG nanogold conjugates (BBI solutions, Crumlin ...
-
No products found
because this supplier's products are not listed.
Katherine J. Turner, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rabbit anti-green fluorescent protein (GFP; Torrey Pines Biolabs, Cat# TP401, dilution 1:1000), rat anti-GFP (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μM 1-NM-PP1 (Toronto Research Chemicals; A603003) was added into one of the cultures to inactivate Cdc2 (Cdk1 ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Karl Frontzek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cell numbers in supplementary figure 4E were determined using “Spots” function in Imaris (Oxford Instruments). Morphometric quantification was done on unprocessed images with identical exposure times and image thresholds between compared groups ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
Human factor α-XIIa (Enzyme Research Laboratories Ltd) activity was measured at an enzyme concentration of 0.17 U/mL in 150 mM NaCl and 50 mM Tris-HCl (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Brad A. Palanski, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and the supernatants were transferred to low-binding ultra-performance liquid chromatography vials (Wheaton #11-0000-100-S) and analyzed on a Fusion Lumos mass spectrometer (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Dorit Möhrle, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... 2) KD (weight ratio of fat to carbohydrate plus protein is approximately 6.3:1, F3666, Bio-serv, NJ). Percentage calories provided by each nutrient category are ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
Equal amounts of protein (70 μg) supplemented with 5x Protein Loading Buffer (National Diagnostics, USA) were preheated (95°C ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Yilun Sun, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... AcquaStain protein gel Coomassie stain (Bulldog Bio); Silver Stain solutions (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Charneal L. Dixon, et al.,
bioRxiv - Immunology 2023
Quote:
... cDNA was synthesized from 1 µg RNA using SensiFAST cDNA Synthesis Kit (FroggaBio; Concord, Canada). qPCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System in conjunction with a SybrGreen System (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Ugo Sardo, et al.,
bioRxiv - Physiology 2023
Quote:
Liver proteins were extracted by physical dissociation (Ultra-turrax, IKA) in PEB Buffer (150 mM NaCl ...