-
No products found
because this supplier's products are not listed.
Lucas Caldi Gomes, et al.,
bioRxiv - Neuroscience 2024
Quote:
... C9orf72 repeat expansion analysis was performed using the AmplideX PCR/CE C9orf72 Kit (Asuragen, Austin, TX, USA). Briefly ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Yingnan Si, et al.,
bioRxiv - Bioengineering 2019
Quote:
... We developed a SSTR2 mAb to target the 1st extracellular domain (cQTEPYYDLTSNA, aa 33-44) and the 2nd extracellular domain (cALVHWPFGKAICRVV, aa 104-118) using hybridoma technology performed by ProMab. The immune splenocytes with the best anti-SSTR2 antibody expression were fused with myeloma cells (Sp2/0 ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Elution was in buffer H containing 0.15 mg/mL 3× Flag peptide (EZBiolab). Peak fractions were diluted with 2 volumes of buffer H and loaded onto a 1-mL SP HP column (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Takumi Koizumi, et al.,
bioRxiv - Biophysics 2024
Quote:
... and then the medium was exchanged with Opti-MEM I (recovery medium) containing 0.3 mM DRAQ7 (BioStatus, Leicestershire, UK) as an indicator for dead cells ...
-
No products found
because this supplier's products are not listed.
Balaji Muralikrishnan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... tuberculosis gyrase and topoisomerase I inhibition kits were bought from Inspiralis (Norwich, UK). Potssium iodide ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Stijn De Munter, et al.,
bioRxiv - Immunology 2023
Quote:
... 10 μM Rho-associated coiled–coil containing protein kinase (ROCK) inhibitor Y-27632 (Abmole) and 5 μM A83-01 (Tocris Bioscience)) ...
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Jian Cui, et al.,
bioRxiv - Immunology 2023
Quote:
... 25 μL of HBSA containing 10 nM mouse FVIIa (Enzyme Research Laboratories, South Bend, IN), 300 nM human FX (Enzyme Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sung-Eun Choi, et al.,
bioRxiv - Pathology 2020
Quote:
... Total protein in the hydrolysed sample was also measured using the Total Protein Assay Kit (QuickZyme) and the relative amount of collagen per protein was analysed.
-
No products found
because this supplier's products are not listed.
Marissa Saenz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Following precipitation of plasma proteins with acetonitrile containing 3.5 ng/mL buprenorphine-d4 (Cerilliant, Round Rock, TX, USA) as an internal standard ...
-
No products found
because this supplier's products are not listed.
Sahiti Kuppa, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 180 μl of either fluorescent protein was added to a 3 mm path length quartz cuvette (Starna Cells Inc.) and maintained at 23 °C in a PC1 spectrofluorometer (ISS Inc.) ...
-
No products found
because this supplier's products are not listed.
Mahlon A. Collins, et al.,
bioRxiv - Genetics 2022
Quote:
... and resuspended in 300 µL of 1 M sorbitol containing 3 U of Zymolyase lytic enzyme (United States Biological, Salem, MA, USA) to degrade ascal walls ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Alan Umfress, et al.,
bioRxiv - Neuroscience 2022
Quote:
... phospho-Ser549 and total Synapsin I (PhosphoSolutions), Fodrin (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Colin L. Hisey, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... a pooled digest (3 µg of protein from the fifteen 15 µg samples) was applied to an SCX MicroSpin column (The Nest Group, Inc.) according to manufacturer’s instructions and fractionated using 50 mM ...
-
No products found
because this supplier's products are not listed.
Takenori Kanai, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and then treated for 8 hrs at 4°C with PBS containing 0.1% goat serum and the following primary antibodies (1 μg/ml): hamster monoclonal anti-mouse podoplanin (AngioBio Co., Del Mar, CA), rabbit anti-mouse osteopontin (Abcam plc. ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
This kit is a sandwich ELISA assay for the quantitative measurement of Mouse DHFR in serum,...
Cat# KITE1074,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Neng Wan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... OA-containing medium was replaced with medium containing lipoprotein deficient serum (880100, KALEN Biomedical). Cells were cultured for 3hr more before staining lysosome with Lysotracker DeepRed (L12492 ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Felix Schreibing, et al.,
bioRxiv - Immunology 2021
Quote:
... The panel of 23 10x-compatible MHC class I Dextramer reagents (Immudex), including 8 control Dextramer reagents was pooled as described above ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Hayao Ohno, Zhirong Bao,
bioRxiv - Microbiology 2020
Quote:
... The microscopes used were (i) a spinning-disk confocal microscope (Quorum Technologies Inc.) consisting of a Zeiss AxioObserver Z1 ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Mengjie Li, et al.,
bioRxiv - Microbiology 2024
Quote:
Total RNA was extracted from mouse lung tissue using an RNA extraction kit according to the manufacturer’s instructions (BioMiGA, China). All materials required for the experiment were treated with DPEC water to remove RNA enzyme (BioMiGA ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Kristin D. Dahl, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... MBP (Myelin Basic Protein, Neuromics Cat # ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Kevin B. Weyant, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... biotinylated DNP containing a polyethylene glycol (PEG) linker was purchased from Nanocs, and 1-oleoyl-2-[12-biotinyl(aminododecanoyl)]-sn-glycero-3-phosphocholine (18:1-12:0 biotin PC ...
-
No products found
because this supplier's products are not listed.
Chance J. Cosgriff, et al.,
bioRxiv - Microbiology 2019
Quote:
... containing 250 μL 0.1 mm glass cell disruption beads (Scientific Industries, Inc.). Cells were lysed using a Fast Prep-24 5G (MP Biomedicals ...
-
No products found
because this supplier's products are not listed.
Wei-Sheng Sun, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 30 mM Imidazole and 0.02 mg/ml DNase I and broken with a Constant cell disruptor at 4 °C and 25 kPsi (Constant Systems). The cell lysate was clarified by centrifugation for 30 minutes at 30,000 x g ...
-
No products found
because this supplier's products are not listed.
Sophia Groh, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... followed by embedding coverslips with Vectashield containing DAPI (Vector Laboratories, Axxora - H-1200) and sealed with nail polish ...
-
No products found
because this supplier's products are not listed.
Sanket S. Ponia, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse anti ZIKV Envelope (#BF-1176-56, BioFront Technologies) and chicken antibody to SENV (#ab33988 ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Amy Q. Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The assay ready plate containing compounds was prepared using an Echo acoustic dispensing instrument (Labcyte) that had 90 nL aliquot of each diluted sample per well ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...