-
No products found
because this supplier's products are not listed.
Sören Kuypers, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Seven and a half microliter of either FITC labeled silica beads (100 nm, Si100-FC-1, NanoCS), TetraSpeck™ beads containing four well-seprarated excitation/emission peaks (360/430 nm ...
-
No products found
because this supplier's products are not listed.
Jesse Garcia Castillo, et al.,
bioRxiv - Immunology 2024
Quote:
... Quantification of IgG for samples was done by diluting serum samples and using the Mouse IgG ELISA commercial kit (Molecular Innovations). For treatment ...
-
No products found
because this supplier's products are not listed.
Eric A. Kirk, et al.,
bioRxiv - Neuroscience 2023
Quote:
... seven-stranded braided steel wires (catalog number: 793200, A-M Systems) that were crimped into a 27 gauge needle ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Frederic Català-Castro, et al.,
bioRxiv - Biophysics 2023
Quote:
... It is composed of seven excitation lasers stabilized through a wavefront filter (Borealis, Oxford Instruments) and the corresponding dichroic optics for multiple beam combinations ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Monica M. Santisteban, et al.,
bioRxiv - Neuroscience 2023
Quote:
... each mouse is placed in a new clean cage containing 5g of nestlet (Ancare) in the middle of the cage ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Omer Adir, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The protein containing fractions were dialyzed in a 12-14 kD membrane (Spectrum Laboratories, USA) against their original resuspension buffer.
-
No products found
because this supplier's products are not listed.
Kyoko Okada, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and bound proteins were eluted in lysis buffer containing 50 mM biotin (Chem-Impex International). For StrepII-sfGFP cleaved NudEL-FL and NudEL-CC used in Figure 5E and F ...
-
No products found
because this supplier's products are not listed.
Khomgrit Morarach, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cells were resuspended in DPBS containing 1% BSA and 1% DRAQ7 (Biostatus). Tomato+ cells were sorted on a BD Influx™ cell sorter ...
-
No products found
because this supplier's products are not listed.
Romina Marone, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The extracellular domain (ECD) of CD123 WT and variants were produced and purified by Icosagen.
-
No products found
because this supplier's products are not listed.
Isadora Matias, et al.,
bioRxiv - Neuroscience 2021
Quote:
Protein concentration in cell extracts was measured by the BCA Protein Assay Kit (Cole-Parmer). Forty micrograms protein/lane was electrophoretically separated on a 10% SDS polyacrylamide gel and electrically transferred onto a Hybond-P PVDF transfer membrane (Millipore ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Caitlin P. Mencio, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 1 mU heparinase I (Seikagaku Corp., Tokyo, Japan), 1 mU heparinase II (Iduron ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Mark E. Corkins, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... then moved to a 1.5ml tube containing 1:1 1xMMR:Optiprep (Cosmo Bio Usa Inc AXS1114542) with a glass pipette ...
-
magnetofection
difficult to transfect cells
Cat# KC30296,
PolyMag 100µL+PolyMag Neo100µL+ CombiMag 100µL+Magnetic Plate MF96000, USD $640.63/KIT
Ask
Andrew S. Flies, et al.,
bioRxiv - Immunology 2020
Quote:
... Digested proteins in PBS were diluted 1:1 in Squalvax (Oz Biosciences # SQ0010) to a final concentration of 0.1 μg/μL and was mixed using interlocked syringes to form an emulsion ...
-
No products found
because this supplier's products are not listed.
Corynne L. Dedeo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Fractions containing scaffolding protein were pooled and concentrated in 12-14kDa MWCO dialysis tubing (Spectrum Chemical, New Brunswick, NJ) by dehydration with PEG 20,000K to a concentration >5mg/mL ...
-
No products found
because this supplier's products are not listed.
Christiane Linster, et al.,
bioRxiv - Neuroscience 2020
Quote:
... using anti-NorEpinephrin Transporter (mouse, Mab technologies; 1/1000) and anti GFP (chicken ...
-
No products found
because this supplier's products are not listed.
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... or whole medium containing 1% dimethyl sulfoxide (DMSO; Bioshop Canada, Burlington, ON) and 20% heat-inactivated FBS ...
-
No products found
because this supplier's products are not listed.
Jay N. Joshi, et al.,
bioRxiv - Genetics 2024
Quote:
... Constructs of Spc105R with deletions or mutations of these domains were injected into Drosophila melanogaster embryos (Model System Genomics or BestGene). The linkage of the transgenes was determined and insertions on the 3rd chromosome were recombined onto the same chromosome as the shRNA GL00392.
-
No products found
because this supplier's products are not listed.
Kevin T. Beier,
bioRxiv - Neuroscience 2022
Quote:
... DNA fragments of 400-1000 bp containing the coding or untranslated region sequences were amplified by PCR from mouse whole brain cDNA (Zyagen) and subcloned into pCR-BluntII-topo vector (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Manindra Bera, et al.,
bioRxiv - Neuroscience 2023
Quote:
... approximately 20 animals were placed on agar plates containing 1 mM aldicarb (CarboSynth) as described previously 26,72 ...
-
No products found
because this supplier's products are not listed.
Shiying Liu, Yue Meng, Pakorn Kanchanawong,
bioRxiv - Cell Biology 2023
Quote:
... The truncated mutants including E-cadherin-mScarlet-I ΔEC (removing extracellular domain 157-709 amino acids) and E-cadherin-mScarlet-I ΔIC (removing intracellular domain 733-884 amino acids) were synthesised by Epoch Life Science, Inc.
-
No products found
because this supplier's products are not listed.
Nemailla Bonturi, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... Plasmids containing the assemblies were recovered using Favorprep™ Plasmid DNA Extraction Mini Kit (Favorgen, Wien, Austria). DNA Sanger sequencing was used to confirm parts and constructs.
-
No products found
because this supplier's products are not listed.
Vitor Mendes, et al.,
bioRxiv - Biochemistry 2020
Quote:
... was mixed in 1:1 and 1:2 (protein to reservoir) ratio with well solution using a mosquito robot (TTP labtech). Initial conditions were obtained in the Classics lite crystallization screen (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Katherine J. Turner, et al.,
bioRxiv - Neuroscience 2022
Quote:
Rabbit anti-green fluorescent protein (GFP; Torrey Pines Biolabs, Cat# TP401, dilution 1:1000), rat anti-GFP (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... the arrays were probed at 1/100 dilution in protein array blocking buffer (GVS) supplemented with E ...
-
No products found
because this supplier's products are not listed.
Mikayla A Payant, et al.,
bioRxiv - Neuroscience 2023
Quote:
... they were immediately incubated anti-rabbit MCH (1:2,000; RRID: AB_2314774) and anti-mouse NeuN (1:1,000; HB6429, Hello Bio, Princeton, NJ) in NDS overnight (RT) ...
-
No products found
because this supplier's products are not listed.
Christopher W. Thomas, et al.,
bioRxiv - Neuroscience 2019
Quote:
... containing a running wheel (Campden Instruments), which were placed within ventilated sound-attenuated Faraday chambers (Campden Instruments) ...
-
No products found
because this supplier's products are not listed.
Owen J. Chen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... containing 10 mM HEPES (Wisent Bioproducts) at 37°C ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... containing 2 mg/ml papain (BrainBits). Papain solution was removed ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priyanka S Radadiya, et al.,
bioRxiv - Genetics 2020
Quote:
... primary cultures of ADPKD cells were suspended in media containing type 1 collagen (PureCol, Advanced biomatrix, San Diego, CA) in a 96-well plate ...
-
No products found
because this supplier's products are not listed.
Benjamin Gan-Or, Michael London,
bioRxiv - Neuroscience 2022
Quote:
... Virus-containing solution was slowly injected (1-2 nl/sec) through a quartz pipette (pulled on P2000, Sutter instruments,) using a Nanoject 3 system (Drummond Scientific Company ...
-
No products found
because this supplier's products are not listed.
Prachiti Moghe, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... containing 10% serum substitute supplement (Irvine Scientific). The COCs were stripped off cumulus cells with 0.5 mg/ml hyaluronidase (Sigma Chemical) ...
-
No products found
because this supplier's products are not listed.
Rohin Banerji, et al.,
bioRxiv - Bioengineering 2023
Quote:
Isolated mouse lungs were ventilated (Kent Physiosuite Mouse ventilator, Kent Scientific) through a tracheal cannula and perfused through two cannulas inserted into the pulmonary artery (PA ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Christopher B. Mulholland, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Naïve ESCs were maintained on flasks treated with 0.2% gelatin in defined media containing 2i (1 μM PD032591 and 3 μM CHIR99021 (Axon Medchem, Netherlands)) ...
-
No products found
because this supplier's products are not listed.
Bastien Casu, et al.,
bioRxiv - Microbiology 2022
Quote:
... Streptomyces cells were mixed with 10 nm Protein A conjugated colloidal gold particles (1:10 v/v, Cytodiagnostics) and 4 µl of the mixture was applied to a glow-discharged holey-carbon copper EM grid (R2/1 or R2/2 ...
-
No products found
because this supplier's products are not listed.
Thanh Kha Phan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... containing five steel homogenization beads (Next Advance Inc). Lung homogenates were then centrifuged at 10,000 g for 5 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Kimber L. Boekell, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cell-surface P-selectin exposure and integrin αIIbβ3 activation was assayed using a two-color mouse platelet activation kit (Emfret Analytics D200) following the supplied protocol ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Minghui Di, et al.,
bioRxiv - Molecular Biology 2023
Quote:
HeLa cells were transfected with DNA (1 ug) expressing mCherry-tagged proteins cultured on 29-mm glass-bottom dish (Cellvis); plasmids (1 ug ...
-
No products found
because this supplier's products are not listed.
Mingrui Guo, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
No products found
because this supplier's products are not listed.
Yusha Sun, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mouse anti-TPH2 (Thomas Scientific, AMAb91108), rabbit anti-TH (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Seren Hamsici, Gokhan Gunay, Handan Acar,
bioRxiv - Bioengineering 2022
Quote:
... Fmoc protected amino acids (Gyros Protein Technologies) were removed through treatment with 20% piperidine/DMF solution for 45 min (three times for 15 min ...
-
No products found
because this supplier's products are not listed.
Takeshi Imai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The filtrate containing YjbI was applied to a Toyopearl DEAE-650M column (Tosoh) equilibrated with 50 mM Tris-acetate buffer (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Natalie K. Trzcinski, et al.,
bioRxiv - Neuroscience 2022
Quote:
... containing four separate extracellular microelectrodes (2 to 7MΩ, Tungsten FHC Inc, Bowdoin, ME) linearly aligned and spaced 584 µm apart ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... proteins were extracted from samples collected in TRI Reagent (Molecular Research Center) according to a modified protocol (65) ...