-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... KLK10 in mouse plasma was measured by using a mouse KLK10 ELISA kit (Antibodies-online, ABIN628061).
-
No products found
because this supplier's products are not listed.
Ka Lin Heck-Swain, et al.,
bioRxiv - Immunology 2022
Quote:
... as described (38) using cTnI ELISA Kit (Life Diagnostic, #CTNI-1-HS).
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2021
Quote:
To investigate Fc receptor binding recombinant Fc receptors with an AviTag were biotinylated using a Bir500 kit (Avidity, Aurora, CO, USA) according to manufacturer’s instructions and purified using a Zeba Spin Desalting Column ...
-
Mouse Calcitonin Gene Related Peptide Type 1 Receptor (CALCRL) ELISA Kit is an ELISA Kit for the...
Cat# abx556045-96T,
96 tests USD $797.5
Ask
M Hazime, et al.,
bioRxiv - Neuroscience 2022
Quote:
GABA concentrations in the extracellular medium of astrocytes was determined using the Mouse GABA ELISA Kit (Abbexa, Ltd.) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
No products found
because this supplier's products are not listed.
Sara Ruiz-Rubio, et al.,
bioRxiv - Neuroscience 2023
Quote:
... It indicates the distribution of the expression of the vomeronasal genes from the V1R receptor family (Suárez et al. 2011; Pallé et al. 2020).
-
No products found
because this supplier's products are not listed.
Dong Wook Jekarl, et al.,
bioRxiv - Immunology 2019
Quote:
... Data related to viral hepatitis were measured using anArchitecti2000 analyzer (Abbott Laboratories, Chicago, IL, USA). Platelet counts were measured using an XE-2100 differential analyzer (Sysmex Corporation ...
-
No products found
because this supplier's products are not listed.
Beibei Wu, et al.,
bioRxiv - Microbiology 2021
Quote:
... that for detection of interferon alpha and beta receptor 1 (IFNAR-1) was purchased from Leinco Technologies, Inc ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Christine E. Peters, et al.,
bioRxiv - Biophysics 2022
Quote:
... FLAG beads were rinsed with the same buffer for an additional elution which was combined with the initial peptide elution and incubated with MagStrep “type 3” magnetic bead suspension (IBA Lifesciences) for 2h at 4°C ...
-
No products found
because this supplier's products are not listed.
Mohamed Mahgoub, et al.,
bioRxiv - Genetics 2019
Quote:
... and H3(1-43) peptides were obtained from EpiCypher. Binding reactions consisting of protein (13 µg) ...
-
Erenumab (Anti-CALCRL/CGRPR) is a fully human monoclonal antibody targeting CGRP receptor...
Cat# A2576, SKU# A2576-1mg,
1mg, $270.00
Ask
Christopher H. Herbst, et al.,
bioRxiv - Immunology 2023
Quote:
... and 1 mg/ml RGD peptide (Selleck Chemicals, #S8008). Blocking antibodies specific for the following proteins were used ...
-
No products found
because this supplier's products are not listed.
Cecilia Perez-Borrajero, et al.,
bioRxiv - Biochemistry 2021
Quote:
The lyophilized TOST-1 and PID-1 peptides were purchased from Proteogenix at 95 % purity ...
-
No products found
because this supplier's products are not listed.
Yulia V. Bertsova, et al.,
bioRxiv - Biochemistry 2022
Quote:
An expression vector for the C-terminal 6×His-tagged ARD protein was constructed by amplifying the ard gene (GenBank Gene ID: 57822953) by PCR with a high fidelity Tersus PCR kit (Evrogen) and the primer pair 5’-GAGGAATAAATTTATGGCTCAGTTAGTCGAT / 5’-GGAAACAAGATCAGATGCACTCTC using the genomic DNA of V ...
-
No products found
because this supplier's products are not listed.
Kwadwo A. Opoku-Nsiah, et al.,
bioRxiv - Biochemistry 2021
Quote:
Peptides were synthesized by Fmoc solid phase peptide synthesis on a Syro II peptide synthesizer (Biotage) at ambient temperature and atmosphere on a 12.5 μM using either pre-loaded Wang resin or Rink amide resin (Sigma-Aldrich) ...
-
Luciferase Reporter Assay Kit (200 tests)
Cat# SLLU-200,
1.0 kit, 200 tests, USD $146.0
Ask
Riley M. Horvath, Ivan Sadowski,
bioRxiv - Molecular Biology 2023
Quote:
... Measurements were performed using SuperlightTM luciferase reporter Gene Assay Kit (BioAssay Systems) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lei Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Type R1 (Trevigen) according to established methods (Sato et al. ...
-
No products found
because this supplier's products are not listed.
N.D. Maxwell, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CA) using probes against the leptin receptor mRNA (Cat# 415951) and Opal 650 dye kit (Akoya Biosciences, Marlborough, MA) to label LepR mRNA ...
-
No products found
because this supplier's products are not listed.
Douglas W. Perkins, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... tumour cells were transduced with lentiviral expression particles containing either: (1) a firefly luciferase gene with a blasticidin-resistance gene (cells denoted -Luc) (Amsbio, LVP326); (2 ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shirsha Saha, et al.,
bioRxiv - Biophysics 2023
Quote:
... receptor was solubilized in 0.5% L-MNG (Anatrace, Cat. no: NG310) and 0.1% cholesteryl hemisuccinate (Sigma ...
-
No products found
because this supplier's products are not listed.
Assaf Alon, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Purified σ2 receptor was reconstituted into lipidic cubic phase (LCP) by mixing with a 10:1 (w:w) mix of monoolein (Hampton Research) with cholesterol (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Stefania Capone, et al.,
bioRxiv - Immunology 2020
Quote:
RBD/ACE-2 neutralization ELISA (ACROBiosystems) was performed according to manufacturer instruction ...
-
No products found
because this supplier's products are not listed.
Yishay Wineberg, et al.,
bioRxiv - Genomics 2019
Quote:
... This was repeated in three experiments in which we used two types of RNA purification kits: the “single cell RNA Purification Kit” (51800, Norgen Biotek) was used in one experiment where we sorted 50,000 Six2-high and 50,000 Six2-low cells ...
-
WB,ELISA
Cat# A5370, SKU# A5370-20ul,
20ul, $47.00
Ask
Qing Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
Mouse tails and AG-haESCs were lysed by Mouse Direct PCR Kit (Bimake) according to the manufacturer’s guidance ...
-
No products found
because this supplier's products are not listed.
Yongrong Qiu, et al.,
bioRxiv - Neuroscience 2022
Quote:
We recorded light stimulus-evoked Ca2+ signals in GCL cells of the explanted mouse retina using a MOM-type twophoton (2P) microscope (74, 75) from Sutter Instruments (purchased from Science Products ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Ojas Deshpande, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 100U of DNAse type I (NZYTech)) ...
-
No products found
because this supplier's products are not listed.
Hengqian Ren, et al.,
bioRxiv - Biochemistry 2023
Quote:
... To the dried peptide, 300 μL of a 1:1 mixture 12 M DCl (35% w/v, Aldrich) and D2O (Cambridge Isotope Laboratory) containing 3% phenol (w/v ...
-
No products found
because this supplier's products are not listed.
Sean C. Booth, Oliver J. Meacock, Kevin R. Foster,
bioRxiv - Microbiology 2023
Quote:
Bacterial cultures were prepared as previously and 1 μL of a 1:1 mixture of wild-type and CDI susceptible pipetted onto the center of a glass bottom petri dish (MatTek, Goethenberg, Sweden) containing 10 mL LB 1.5% agar ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Inbar Segal, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse anti-GAPDH (1:1000; Applied Biological Materials), mouse anti-GFP (1:1000 ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Amina Benhadda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Antibodies (1:10,000; goat anti-mouse-IR800, Advansta# R-05060-250 and goat anti-rabbit-IR700 ...
-
No products found
because this supplier's products are not listed.
D Muñoz-Reyes, et al.,
bioRxiv - Biochemistry 2022
Quote:
... NCS-1ΔH10/Ric-8A-P2 peptide and NCS-1ΔH10/Ric-8A-P3 peptide were performed using a Tycho NT.6 instrument (NanoTemper Technologies). Proteins at 10 μM in their corresponding final buffers (see above ...
-
No products found
because this supplier's products are not listed.
Zijun Wang, et al.,
bioRxiv - Immunology 2021
Quote:
... The developing reaction was stopped by adding 50 μl 1 M H2SO4 and absorbance was measured at 450 nm with an ELISA microplate reader (FluoStar Omega 5.11, BMG Labtech) with Omega MARS software for analysis ...
-
No products found
because this supplier's products are not listed.
Eleni Kafkia, et al.,
bioRxiv - Systems Biology 2020
Quote:
... mouse anti-lamin B1 (1:500, Atlas Antibodies, AMAb91251) and anti-mouse Alexa Fluor 555 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Carla Inês Soares Rodrigues, et al.,
bioRxiv - Systems Biology 2022
Quote:
... The culture pH was kept at 5.0 by automatic addition of 0.5 mol.l-1 KOH (BioStat controller, type 8843415, Sartorius AG, Germany).
-
No products found
because this supplier's products are not listed.
S. John Liu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were desalted using MicroSpin Columns (The Nest Group) and resuspended in 4% formic acid and 3% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Lucia Lorenzi, et al.,
bioRxiv - Genetics 2019
Quote:
... RNA of individual cell types was obtained from ScienCell Research Laboratories or isolated from cell types collected at Ghent University Hospital ...
-
No products found
because this supplier's products are not listed.
Stephanie L. Baringer, et al.,
bioRxiv - Neuroscience 2023
Quote:
... chilled hexafluoroisopropanol (HFIP) was added to Aβ42 peptide (Alfa Aesar, J66387) to obtain a concentration of 1 mM ...
-
No products found
because this supplier's products are not listed.
Jose A. Diaz-Olivares, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The transmitted light is collected by a converging-type lens with a focal length of 31.6 mm (770303-9020-000 2:1, Carl Zeiss, Jena, Germany) and guided to the spectrometer by an optical fiber (600 μm core diameter ...
-
No products found
because this supplier's products are not listed.
Shweta Mendiratta, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The cells were incubated with 125 nM of each probeset (one for histone genes and second one for a control gene FOS in the Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies; SMF-HB1-10) overnight at 37°C in humified chamber ...
-
No products found
because this supplier's products are not listed.
Veronika Miskolci, et al.,
bioRxiv - Immunology 2020
Quote:
... fine tip (type E) of a line-powered thermal cautery instrument (Stoelting, Wood Dale, IL) was placed into the E3 medium ...
-
No products found
because this supplier's products are not listed.
Fred E. Fregoso, et al.,
bioRxiv - Biochemistry 2021
Quote:
Cell lysates of Arpin wild-type and mutants C204S and W195D were incubated with glutathioneagarose resin (GoldBio) for 2 h at 4°C (rocking) ...
-
No products found
because this supplier's products are not listed.
Petros Zafeiriou, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Total starch content was determined using a Total Starch HK kit (Total Starch hexokinase kit, AOAC Method 996.1 1; Megazyme, Bray, IE) following manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Yi Xiang See, Kaijing Chen, Melissa J. Fullwood,
bioRxiv - Genomics 2021
Quote:
... Cells were fixed in 1% formaldehyde and sonicated using the truChIP Chromatin Shearing Kit (Covaris) on the ME220 Focused-Ultrasonicator (Covaris ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Madhulika Tripathi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we used AAV8 mediated gene delivery of mEsrra gene cloned under the control of mouse Alb promoter (Vector Biolabs, USA). 8 weeks old male C57BL/6J mice were used for liver-specific Esrra overexpression (Alb-mEsrra) ...
-
No products found
because this supplier's products are not listed.
Adriana Adolfi, et al.,
bioRxiv - Genetics 2020
Quote:
... and G16 from cage 1:3B) using the NEXTFLEX PCR-free library preparation kit and NEXTFLEX Unique Dual Index Barcodes (BIOO Scientific) following the manufacturer’s instructions ...