-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
Di Wan, Tongchuang Lu, Chenyang Li, Changlong Hu,
bioRxiv - Neuroscience 2023
Quote:
... cAMP levels in hippocampal neurons were measured using a cAMP ELISA Kit (NewEast Bioscience, China) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse sera (Complement Technology) was incubated with C1q (4.8 ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Qian Xue, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-mCherry (Encor Biotechnology, MCA-1C51), rabbit anti-pY118 Paxillin (Novus Biologicals ...
-
No products found
because this supplier's products are not listed.
Ninad B. Kothari, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the mouse was subcutaneously administered CNO (Tocris) to bilaterally inactivate the pLTN ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Marta Perera, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse ESCs were cultured in 8-wells slides (Ibidi). ESC immunostaining was carried out as previously described in Canham et al. ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Nicolò Maganzini, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Mouse Fc-capture biosensor tips were purchased from Sartorius. Chicken plasma (cat # ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Thomas Dal Maso, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mouse genotyping was performed with WONDER Taq Hot START (Euroclone) using the following primers ...
-
No products found
because this supplier's products are not listed.
Pierre Gillotay, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... anti-monomeric Kusabira-Orange 2 (mouse, MBL amalgaam M-168-3M) at 1:200 ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was intraperitoneally injected with 100 mg/kg BrdU (APExBIO, Houston, TX, USA) dissolved in saline ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Stetzik Lucas, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mouse coronal tissue sections were viewed under an Eclipse Ni-U microscope (Nikon); images were captured with a color Retiga Exi digital CCD camera (QImaging ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Tae Yeon Yoo, Timothy J Mitchison,
bioRxiv - Cell Biology 2020
Quote:
... and Ingenio® electroporation kit (#50117, Mirus). After 5 days of transfection ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...