-
No products found
because this supplier's products are not listed.
Miho Araki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... An Sftpc ELISA kit for the mouse was purchased from Aviva Systems Biology (OKEH01170) ...
-
No products found
because this supplier's products are not listed.
Na Fei, et al.,
bioRxiv - Physiology 2023
Quote:
... Serum LBP level was measured by a Mouse Lipopolysaccharide Binding Protein ELISA Kit (HyCult Biotechnology, Uden, The Netherlands). All assays were performed according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Cristina Marí-Carmona, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and anti-mouse (Agrisera) were used as secondary antibodies at 1/20,000 and 1/10,000 dilutions ...
-
No products found
because this supplier's products are not listed.
Laura Zein, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-GAPDH (Hytest Cat# 5G4cc-6C5cc ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Chie Min Lim, et al.,
bioRxiv - Microbiology 2024
Quote:
... connection kit (DP21-SAL, Olympus, Japan), and hand switch (DP21-HS ...
-
No products found
because this supplier's products are not listed.
Susanta Chatterjee, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... random nonamers (Eurogentec Reverse Transcriptase Core Kit) was used to prepare cDNA by using the 200 ng of the total RNA for 10 μl of reaction and the produced cDNA was used for comparative quantitation of mRNA expression ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Darian Williams, et al.,
bioRxiv - Cell Biology 2021
Quote:
... KLK10 in mouse plasma was measured by using a mouse KLK10 ELISA kit (Antibodies-online, ABIN628061).
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the Mouse Interleukin 10 ELISA Kit (Biosensis®, BEK-2046-1P)
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Maxime De Rudder, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Factor V serum protein concentration was assessed by ELISA following manufacturer’s instructions (Mouse factor V ELISA kit orb409284, Biorbyt).
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
Cat# RK289,
USD $225.0/kit
Ask
Richard J. Roller, et al.,
bioRxiv - Microbiology 2021
Quote:
... mouse monoclonal anti-ICP27 (Virusys) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Mélanie Roussat, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... γ-Tubulin (Exbio, 1:1000, mouse), CTIP2 (abcam ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Ueki, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and the HA Tag Polyclonal Antibody as primary antibodies and an anti-mouse IgG-gold (40 nm) antibody (40 nm Goat Anti-Mouse IgG gold conjugate, Expedeon) and the anti-rabbit IgG-gold (10 nm ...
-
No products found
because this supplier's products are not listed.
Mizuki Yamamoto, et al.,
bioRxiv - Microbiology 2021
Quote:
... and mouse anti-VSVM (1:1000, 23H12, Absolute antibody). The Secondly antibodies used were HRP-linked donkey anti-rabbit IgG antibody (NA934 ...
-
No products found
because this supplier's products are not listed.
Daniel J. Rawle, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse serum was collected in Microvette 500 Z gel tubes (Sarstedt) with GzmA levels determined using a GzmA ELISA kit (MyBioSource ...
-
No products found
because this supplier's products are not listed.
Ji-il Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mouse DRG was incubated with Calbryte520AM (10 μM, AAT Bioquest, #20653). After 45 minutes ...
-
No products found
because this supplier's products are not listed.
Xiong Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse was intraperitoneally injected with 100 mg/kg BrdU (APExBIO, Houston, TX, USA) dissolved in saline ...
-
No products found
because this supplier's products are not listed.
Joaquín J Rodriguez Galvan, et al.,
bioRxiv - Microbiology 2024
Quote:
... TMPRSS2 kit from BPS Bioscience (#78083) was used and instructions were followed from the kit for kinetic measurements ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Giovanny J. Martínez-Colón, et al.,
bioRxiv - Immunology 2021
Quote:
... n2019-nCoV (Biosearch technologies, KIT-NCOV-PP1-1000). For subgenomic N-gene quantification ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
No products found
because this supplier's products are not listed.
Philippos Demetriou, et al.,
bioRxiv - Immunology 2019
Quote:
... the Quantum Simply Cellular anti-mouse IgG kit was used (Bangs Laboratories, see further details in next section). We counted two CD2 molecules for each anti-CD2 IgG detected as we have previously found that the anti-CD2 mAbs bind bivalently at 10 μg/ml59 ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jiechao Zhou, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse sera (Complement Technology) was incubated with C1q (4.8 ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-mouse heparan sulfate (10E4 epitope, 1:100, AMSBIO, catalog F58-10E4), rabbit anti-mouse NeuN (1:250 ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... ANK-G (mouse, Antibodies incorporated), SYP (guinea pig ...
-
No products found
because this supplier's products are not listed.
Joanne Boldison, et al.,
bioRxiv - Immunology 2022
Quote:
... directly conjugated goat anti-mouse IgA (Cambridge Bioscience), rabbit anti-mouse TLR7 (Novus Biologicals) ...
-
No products found
because this supplier's products are not listed.
Marta Perera, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Mouse ESCs were cultured in 8-wells slides (Ibidi). ESC immunostaining was carried out as previously described in Canham et al. ...
-
No products found
because this supplier's products are not listed.
Nicolò Maganzini, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Mouse Fc-capture biosensor tips were purchased from Sartorius. Chicken plasma (cat # ...
-
No products found
because this supplier's products are not listed.
Robert N. Plasschaert, et al.,
bioRxiv - Neuroscience 2021
Quote:
RAW264.7 mouse macrophage cells (ATCC; confirmed by STR profiling, IDEXX) were transduced with increasing multiplicity of infections with LVV.GRN or LVV.GBA vector ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Thomas Dal Maso, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Mouse genotyping was performed with WONDER Taq Hot START (Euroclone) using the following primers ...
-
No products found
because this supplier's products are not listed.
J. Tabitha Hees, Angelika B. Harbauer,
bioRxiv - Neuroscience 2023
Quote:
Primary mouse cortical neurons were seeded in 6 well plates (Greiner) at a density of 2*106 per well and maintained in NB+B27+PSG as described above ...
-
No products found
because this supplier's products are not listed.
Stetzik Lucas, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mouse coronal tissue sections were viewed under an Eclipse Ni-U microscope (Nikon); images were captured with a color Retiga Exi digital CCD camera (QImaging ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Ghalia Boubaker, et al.,
bioRxiv - Microbiology 2019
Quote:
... the CleanTag Ligation Kit (TriLink BioTechnologies) was used to prepare small RNA stranded libraries from total RNA (1µg RNA per library) ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...